Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2043  (registered. 2012)
Contig Information
Length 590 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115483126|ref|NP_001065156.1|| Os10g0533600 [Oryza sativa (japonica cultivar-group)]
Score 283
Evalue 1.00E-74
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2043
AGAGGGGGAAGCTTCTCCACCAGAGTCCCCAAGCCCATGAACGACTAGTCGCTGCGAAGCACCAACCCTAGAACCCAACCCTGCTCTCCCCCCCTCCTCG
GCTCCTCCCCCTCGCGAGCGGCGACGAAGAGGCCATGGATACCTCCGGCGGCGGCGCCGCCGCGGGCGGGGCCGCGCAGATCCAGGGGATGGCGACACAC
GGCGGCCGCTACGTGCTCTACAACGTCTACGGCAACCTCTTCGAGGTCGCCTCCAAGTACGCCCCTCCCATCCGCCCCATCGGCCGAGGCGCCTACGGCA
TTGTCTGCGCGGCGGTTAGTTCGGATACAGGAGAGGAGGTTGCGATCAAGAAGATTGGAAATGCGTTTGACAACCACATCGACGCCAAGCGGACGCTGAG
AGAAATAAAGCTTCTTCGCCACATGGACCATGAGAATATTCTTGCCATAAAGGATTTAATACGCCCCCCAAGAAGAGATGATTTTAAGGATGTGTACATT
GTTACTGAGTTGATGGACACGGATCTCCACCAGATCATTCGCTCAAATCAATCATTGACTGACGACCATTGCCAGTACTTCTTGTATCAG
page-top