Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2042  (registered. 2012)
Contig Information
Length 692 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222617300|gb|EEE53432.1|| hypothetical protein OsJ_36514 [Oryza sativa Japonica Group]
Score 424
Evalue 4.00E-117
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2042
GTTGTTACATTTTCTGCGATCCTGAATGCTTGCAGTCGCTGTAATAACTTTGAAGATGCAGCCCTATTACTGGAACAACTTCGCTTGTTTGATAACTTTG
TCTATGGTGTTGCGTATGGGCTCCTTATGGGTTACCAAGAAATTTGGTCGCAAGCACAGTCCCTTTTTAATCAGCTGGGACGCATGGATTCTCCAACATC
GTCTGCCTTTTATAATGCTCTTACTGATATGCTGTGGCATTTTGGCCAGAGGCAAGGAGCTCAGTTAATTGTGCTCGAAGGGGTAAATCGCCGTGTGTGG
GAGAACACATGGAGTGAGTTTTGCTTGGACCTGCACCTTATGTCATGTGGTGCAGCTCAAGCAATGGTCCATGCATGGCTCCTGAATGTGCGCTCTATTG
TCTTCGAAGGACGAGCTATGCCTGAGTTTCTAAGCATTCTGACAGGGTGGGGAAAGCATAGCAAGATTGCGGGCGCAAGCACTCTTCGCCACGTCATCGA
AGCACTTCTCAACTCAATCGGAGCACCGTTTCAGGTTGAGCGATTCAACATTGGAAGGTTTGTGTCGCCCAGCGTCGTGGTGGCTGCCTGGTTGAGAGAA
TCCGGCACCATCAACATGATACTCCTCAGTGACGAGCGTGCGCAGCGTGCAAGCCCATCCAATCTGGTGCCGAGGTTGGAGGCGCTGCAGTT
page-top