Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig20418  (registered. 2012)
Contig Information
Length 855 bp
Clones alternative view 33 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 2
Wh_EM Dormant seed with water absorption 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 4
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XA Root 2
WH_XB Root 1
WH_XD Root, treated at 50 microM Al for 6h 6
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|209730620|gb|ACI66179.1|| AP-2 complex subunit sigma-1 [Salmo salar]
Score 286
Evalue 3.00E-75
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig20418
TTTTTTTTTTGATTGGAGAAAAGACTGCCATCATGATTGCTAATGAAATGCGTGAAGATGGCAAGGAATTCCACGGCACCTAGTTACAGAACGATCCACA
ACGAACCCCACCAAGCAACCATCATAATGTTTTTTTCTAGAAAGCAGCCATTTCTAGAAGGCAGCCATAAAGTTGGTGAACCAGGGGTAATCATAATAAC
AGCTACAACAGAATTGTACAAACGGAGAAAATTCTTCGACATGGCAGAAGGAATGGGTTTTGCTTTTGCGTTTAGTTATCTCCCCATGCACGCTGGCGAC
ACAGTTTCTTCTTAATCCAGCTTCTCAAGTTCACCCATTCTCTCTATAATCGCCTTTTTGCTTGTTTCTTGCAACTCTCCAGCGAGAATAAACTCATCCA
ATATCAAGTAAACCTTGTGGAAGTTAAATACTAAATCAAGTTCACACACGTTGCTGAAGAAATGGTCCAATATCTCCACAAATAAGTGGATACATTCCAA
GTATACCAACTCATTATCCGTGATATCTACACATATTGAGAAAAATAGTCCTGCATATCTCCTGTAGATAACTTTGTGCGTACGGAACTCAACGAAGTTA
GTGAACTTGGGGTCCCTGTTGACGACCAGCCGATGCACCTCATATTCAACCTTGTGCTTCTCTGAGTCCTCGAGCGGGACGTAGTACTTGGCCAGCCGCG
TCTTCCCCTGCCGATTCTGCAACAGGATGAAACGGATCATGCTGGGTGATGATGATGACGACCACGCTTGAGAATTCGCGGGATTGGAGCTTGGGAGGGG
AATGAATCGGATTTGTGTTGCTTGGTTTGTTGGGTTGGCTATATGCAGATGAGCT
page-top