Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig20391  (registered. 2012)
Contig Information
Length 561 bp
Clones alternative view 53 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_oh Pistil at heading date 2
Wh_yd Spikelet at late flowering 8
Wh_EM Dormant seed with water absorption 6
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_KMP Shoot grown under continuous light 4
Wh_OKCS Seed DPA5 4
Wh_PCDAM Anther at meiosis 2
Wh_VSCB Liquid cultured tissue 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 3
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 4
WH_SP 2
WH_XA Root 6
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|291410763|ref|XP_002721657.1|| PREDICTED: histone cluster 1, H2ag-like [Oryctolagus cuniculus]"
Score 209
Evalue 2.00E-52
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig20391
TTTTTTTTTTAAGCTACTGCAATTTCCATTCCAGATTTCTTCCAGTACAACACCAGCTCACAAGACGGGAGCAGACACACACCAGCGAAACACTGCGCAT
ACACGGAGAGCCACGAACCCTAGACAGCAACTAGATAGATACCACTACTACTCTCGGTCGGACGGCGGCGTGGCGAGCTGGACGGCTGGGCCCTCGGCCT
AGCCGCCGAAGCCGTAGAGGGTGCGGCCCTGGCGCTTGAGCGCGTAGACGACGTCCATGGCGGTGACGGTCTTGCGGCGGGCGTGCTCGGTGTAGGTGAC
GGCGTCGCGGATGACGTTCTCGAGGAAGATCTTGAGCACGCCGCGGGTCTCCTCGTAGATGAGCCCCGAGATGCGCTTCACGCCGCCCCTGCGCGCCAGC
CGCCGGATCGCCGGCTTGGTGATGCCCTGGATGTTGTCGCGGAGCACCTTCCGGTGGCGCTTCGCGCCGCCCTTGCCGAGCCCCTTGCCTCCCTTGCCGC
GGCCCGACATCTTCCTCCTCTTCTCTCTCTTGGGGGATTGGATTGGATTGTTTCCTCGTGC
page-top