Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig20388  (registered. 2012)
Contig Information
Length 1395 bp
Clones alternative view 30 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 1
Wh_DPA20 Seed DPA20 1
Wh_PCDAM Anther at meiosis 4
Wh_VABA Shoot with ABA treatment 2
Wh_VHS Shoot with heat shock treatment 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 4
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 4
WH_XA Root 1
WH_XB Root 3
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115435934|ref|NP_001042725.1|| Os01g0276100 [Oryza sativa (japonica cultivar-group)]
Score 695
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig20388
CCTCCCCGCCCCCCGCCGCCGCCGCCGCCGCCGTTGACACTACCCGCGAATCTCCTTCTTCCGAGTGGCGGAGAGGAGGCATGGCACTCCGGAGGCTGCT
TCAGGGGATTGTCCTACCGCGGACGACGGGCCGGCATGTTGGGGCATCGTTTTCCACGGAGGCTGGGGAGACTATCCGCGCAACCCTGTTTCCCGGTGAT
GGCATCGGGCCTGAGATCGCCGAGTCGGTCAAGCAGGTATTCAATGTTGCAGGTGTACCGATAGAATGGGAAGAACATTATGTTGGTACGGAAGTTGATC
CCAGAACAGAGAGCTTTTTGACATGGGAGAGCCTGGAGTCTGTGCGTAGAAACAAAGTTGGCTTGAAAGGTCCTATGGCTACACCTATTGGAAAAGGCCA
CCGTTCTTTGAATCTTACATTAAGGAAAGAACTTGGACTCTACGCCAATGTCAGACCTTGCAACAGCCTCCCAGGCTACAAGACTAGATATGATGATGTG
AACCTTGTGACAATCCGTGAAAATACTGAAGGAGAGTATAGTGGCCTTGAGCATCAGGTTGTGAGGGGTGTTGTGGAAAGTTTGAAAATTATTACCCGCC
AAGCAAGTTTGAGAGTGGCAGAGTATGCTTTCCATTATGCCAAAGCCAATGGCAGGGAGAGGGTCTCTGCGATACATAAAGCTAATATCATGAGGAAAAC
AGACGGACTTTTCCTCAAGTGTTGCCGTGAAGTAGCTGAGAAGTACCCTGAAATCACATATGAGGAAGTCATTATTGACAATTGCTGCATGACACTCGTG
AAGAATCCTGGTACATTTGATGTATTAGTGATGCCAAATCTGTATGGTGACATTATTAGTGATCTATGTGCTGGTTTGATCGGAGGATTGGGCTTAACTC
CCAGCTGCAACATTGGTGAAGGTGGCATTTGTCTGGCAGAGGCTGTTCATGGTTCTGCACCTGATATCTCTGGCAAGAACCTTGCAAACCCAACTGCTCT
TATGTTGAGTGCTGTTATGATGTTGCGCCACTTGCAATTCAATGACCAAGCAGACCGGATCCACAATGCCATCCTCCAGACAATTGCCGAGGGGAAGTAC
AGAACCGCTGATCTTGGTGGGAAGTCATCAACATCAGACTACACAAAAGCAGTTTGCGATCATATCTGAGCACCAGCTGCTCTTTCTCTCGATTATTTGC
CTCCCACCTAATTTTGTTGCATACCAGGAGCTTTAGCCTGAGTAGGTTAAGTGGCAGGCACCTCGATTTCCTTGGGTGTTAAGACACCATTTAAGGCTCC
TGAATAATTCTCGCATTCTTGTCCTTGGAAAAGTTTTACCAGCATTGCAGTCAAGCTGAAGAATCGTATGTAATAATCATTGGCAGCATCAGCGC
page-top