Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig20383  (registered. 2012)
Contig Information
Length 1939 bp
Clones alternative view 62 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 4
Wh_dL Crown of seedling 1
Wh_e Seed DPA10 2
Wh_r Root 5
Wh_CSEC Callus 1
Wh_EM Dormant seed with water absorption 4
Wh_EMI Dormant seed with water absorption after breaking 7
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 3
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 2
Wh_VABA Shoot with ABA treatment 4
Wh_VSCB Liquid cultured tissue 6
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 3
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XF Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218197310|gb|EEC79737.1|| hypothetical protein OsI_21076 [Oryza sativa Indica Group]
Score 1047
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig20383
TTTTTTTTTTCTAACCGGACGAACCAACTTTATTATTCTGGAAACGAAGACGACTCACTCTACCCAGCAGCAGCTCACGAGTTCAAACCAGCTAGTCGCA
CACATACATTACAGTCCATGAATGTCCATCCATCAAAAACCAACTCTCCTGCCGGGCCCCGACCGGCCCGGCGCAGCTTAGTTAACTTAGGTGCAAGGGG
CGAGCCTAGGAGGACTGCCGGAGCTCAGGGCGCACGAAGTCGGCGTCGGCCGTCACCGAGATGTCGACGGTGGGCCTCAGCTCGGCGCAGACCTCGATGG
CGCCGTGGACGGGGTCCGACATGAAGTTGCTGATGAGGTCCTGGTTGATGGGCTCGTCCTTGTCCACCGTCACGAACGCCTGCTGGGTCAGGATGTAGTC
GAAACGGGGCGCCCACTTCCTCGACCCCAGACGCGCCGTCGTCGAGCAGTTGTCCACCATGAAGGCCACCCCGCGCGCGTGCATGAAGGGGTTCAACGAG
TCCACCGACTCGATCACGCTCTCGTTGATGATCTCAGAGTAGGAGTGCCCCTTCTTCCTCAGCACCTCGATCTGGGCCATCATAAGTGCAACATAAACTC
CAGCCGTGAAGGGGTGGAGCGGGCCAAGGTCACCATCTGGCCGGGTCGAGCGCACCTTTTCGCCGACCTTCCACATGCGAGTTTGGTCGATTTTGCCCAT
AGGGAAAGCAGGAAGGCCTTCCTTGTCATAAAACCTCCGACCAGCCAACACAACACTCCGGATTTCACTTCCAGAGGCAACATCTTCGTAGCATTCGTAG
AGTATGTCTATGCAAGGGTAGAATGATGCACTGTATGCCTTGTTGAACTCCTTTTTGCCTTCCTCACTCAAAGAGTTGTACACCTCAAGCATCCCCTTCT
TTGAGATGGTCTTAGAGATAATTCCAGTGATGCCCTCCACGGTGCTTTTGTATGCCAGCTCCTCGTCCATTCCTTGCTCTGTGTATCTCCTAAAGAGAGC
CTCCACAATGCCATGGACAGCGCCCAGCAAAATTCCTCGCTCCCCAAAGATATCACTCTTGTACTCCTGTTCTAGAGTAGTAGCAAAGGTGAATGGGGAT
CCTAGTGCAACCGACCATCCAAGAGCAACATCAGTGGCCCTTCCATCAACATCCTGGTGGACAGCAAAGCTAGCGTTGATGCCAGCACCATTTACTTCCT
TGCCCTGAACATACAGTCTCCGAACCGACGGGCCCATCCCCTTGGGACACACAGCAACGACGCTGATGTTTTTGGGGAAATCAAGGCCATGTGATTGCAG
ATGACCAAGGAGAAACCCATGAGATAAACCAAGAATGCTGTTTGGTTTCATGTGAGAGAAGATCTTCTCATAGTTGTCTGCCTGGGCAGAATCTGAAATC
AACAGCAGCACAAGATCACTGCCAGAGACCGTCTCCCATATGTCTCCCAAGGTTCCGTTCTCCTCGGTGAATCCAGCACCACGTGCTTCCTCAAAAGACT
TGGAACCTTTCCTGAGGCCAATCTTGACGACGATGTCAGACTTGGCTTCCACCAGGGAATCCCTCAGGTTCTGGGCCTGCGCCGGACCCTGGGAGCCCCA
TCCGATGACGCCGATCTGCTTGACGCCCTTGAACGCCTCCGGGAGCAGCGGGAAGAGGTTCCGCCCGCCCCTCACGATGTACTCCTCGTGGCCGGCGAGG
GAGACCTTCTCCTTGTTGAAGACGGCGGTGTCGAAGTCGAGCGACGGCATGGCGGCGCCGACCTTGGCCGGGGCCGCGACCATGGCGGCGACCGCGCGGC
GGCGGGTTAGGGCGCATGCGGGGTGGGATGCGGCCGGGGAGAAGGCGACGGAGGAGGATGCGGCGGCGGCGGCGGCGGCTAGGGTTTTGGGGTGGGAGAA
GGGGGCGAGGGTGGATGCCGCGGAGGAGGTGGGCGCCGC
page-top