Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig20373  (registered. 2012)
Contig Information
Length 974 bp
Clones alternative view 51 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 1
Wh_V4816 Shoot grown under cold condition for 16days 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 3
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23Ž 5
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 7
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 10
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 15
WH_SP 2
WH_XV Leaves, plant was grown at constant 23Ž 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|1657859|gb|AAB18209.1|| chlorophyll a/b-binding protein WCAB precursor [Triticum aestivum]
Score 521
Evalue 6.00E-146
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig20373
TTTTTTTTTTCACAACATTCAAGCTGGACAAACCTTGCATTGCTTTTGCACAAATTCTCATAATTTACATCATGGTAGTACAACTCAGACTGCACAACAA
CACACTTTATGGCGTGCACAATCTCCAAGACATCTTACTTGCCGGGGACAAAGTTGGTGGCGAACGCCCAGGCGTTGTTGTTGACGGGGTCAGAGATGTG
GTCAGTGAGGTTCTCTAGTGGTCCCTTGCCCGTGACGATAGCTTGGACAAAGAAGCCGAACATTGAGAACATGGCGAGGCGACCATTCTTAATCTCCTTC
ACCTTGAGCTCGACGAATGCCTCGGGATCGTCGGCTAGGCCGAGAGGGTCGAAGCTGCCTCCTGGGTATAGTGGGTCGACGATCTCGCCAAGTGGGCCGC
CGGCAACGCGGTACCCCTCGACCGCACCCATGAGCACGACTTGGCATGCCCAAATAGCTAGGATGCTTTGCGCGTGCACAAGGCTGGGATTGCCGAGGTA
GTCAAGACCACCCTCACTAAAGATCTGGGAGCCGGCCTTGAACCAAACGGCCTCGCCAAACTTGACGCCATTGCGGGCGAGCAACTCAGGGAAGACACAA
CCAAGTGCCCCAAGCATGGCCCAACGACAGTGGATCTCCTCCAGCTCCCGGTTCTTGGAGAAGGTCTCCGGGTCAGCCGAAAGTCCAGCAGTATCCCAAC
CATAATCGCCAGGGAACTCACCGGTGAGGTAGCTTGGGGGCTCACCAGAGAGTGGGCCGAGGTACAACACACGGTCGGCACCGTACCATGGGCTGCCAGA
GGAAACCTGCTTCGCCTTCGCTGCAGTCTTGCGCATGGTGACGCGGGCCTCGCGGAAGAGAGCCGATGACGACACGTTCTTCACCGCCTTGCCGGCAAAG
GTTGAGGAGGAGAGGGACATGGTGGTGGTCGCCATTGGAAGGCTGATAAAAGTGTCTGCTGTATTGATTCTCCA
page-top