Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig20352  (registered. 2012)
Contig Information
Length 709 bp
Clones alternative view 68 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 5
Wh_oh Pistil at heading date 1
Wh_r Root 2
Wh_EM Dormant seed with water absorption 3
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 2
Wh_V4816 Shoot grown under cold condition for 16days 7
Wh_VSCB Liquid cultured tissue 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23Ž 4
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 3
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_SP 4
WH_XA Root 4
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 6
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XF Seedling, infected with leaf rust 3
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|194704382|gb|ACF86275.1|| unknown [Zea mays]
Score 169
Evalue 2.00E-40
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig20352
CATGCTTGCTACGAGACACTAACTACTGGAAGTTAAGAGTGCTAAACAGCAGTAACGCTTAGACATGTTTGCAATGCGCTACTCGAACGGGATACATATA
TTGTCAGAGGATTCCTCAGAGCGTGCGACAACAGCTGCAGCGATCACAATAAGCAACAACACATGCACGCCGAAGCATTCCCACCGACGCCACAGCTCCA
AACCAAAATACATAACAAAGCCAGTTTATGTGCTAACAAAAACTTGCAAACAACAGGGGTGAATAATGATAGTTGTGATTGTTTTTTATTAGCAGAGACT
TGCATCGAAACATGCGACGTGGCAGGGTCTCTGTCAGCCGCTTTCAGCGTTGAGCTCAATGGGACGGCGATGACGACGATGAAGCCTCATGCTCGTGTGC
ATGTCCATGACCATGCGCGTGATCATCATGGCCATCCCAAGGATGACGCATACCCAAGAGCACAGCGCCGTCCTGTTTAGCCCTGTAGAAAATCCAAAAC
CACATGGTGGCGCAGAGGCCCTTGCCGGCGATGGTGTGCCAGCGCTTGTTGTGGGGGATGGTGTAGCCCTTGTACGTCGTGCCGCCGTGCGCGCCGCCGC
CGCCCATCGCCGCCGCCCGCCTCTTCTCGGTCGGTGTCGCCTCGTCTGGGGGATTGTCTCCGCCTCTCTGTGTGTGCGCGCGTGGCTCGTGCGGGGTGGG
GGTGGGCCT
page-top