Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig20294  (registered. 2012)
Contig Information
Length 1204 bp
Clones alternative view 17 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_CSEC Callus 1
Wh_DPA20 Seed DPA20 1
Wh_EM Dormant seed with water absorption 1
Wh_RDr Root of dessiccated seed 1
Wh_SHDr Shoot grown with dessication 1
Wh_V4816 Shoot grown under cold condition for 16days 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 3
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XA Root 1
WH_XB Root 1
WH_XD Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242039557|ref|XP_002467173.1|| hypothetical protein SORBIDRAFT_01g020910 [Sorghum bicolor]
Score 672
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig20294
GGAGAAGTTGAAAGGCGTATTGTGTCTCAGCTGTTGACCCTTATGGATGGGCTTAAGTCCCGTGCGCATGTTATTGTTATGGGTGCTACAAACCGCCCAA
ACAGTATTGATCCTGCTCTCAGAAGATTTGGTAGGTTTGATCGTGAGATTGACATTAAGTCCCTGATGAAGTTGGCCGTCTTGAAGTTCTCAGGATTCAC
ACCAAAAACATGAAGTTAGCTGAAGATGTTGAACTGGAACACATTTCACGGGACACCCATGGGTATGTTGGTGCTGATCTTGCTGCTCTTTGTACTGAGG
CTGCTCTTCAGTGCATTCGTGAGAAGATGGATATTATAGATCTTGAGGATGAGACCATAGATGCTGAGATACTGAATTCTATGGCTGTGACAAACGACCA
TTTCAAGACTGCACTAACGACAAGCAACCCATCTGCTCTCCGTGAAACTGTTGTTGAAGTTCCCAATGTCTCTTGGGAAGATATTGGTGGTCTGGAGAAT
GTCAAGCGGGAATTGCAGGAGACTGTCCAATACCCTGTGGAGCATCCAGAGAAATTCGAGAAGTTTGGCATGTCTCCTTCCAAAGGTGTTCTGTTCTATG
GTCCTCCTGGCTGTGGTAAAACCTTGTTGGCCAAGGCAATTGCAAATGAGTGCCAGGCTAACTTCATCAGTATCAAGGGACCTGAGCTGCTGACCATGTG
GTTTGGTGAGAGTGAGGCTAATGTGCGTGAGATCTTTGACAAGGCTAGAGGGTCAGCACCATGTGTCCTCTTCTTTGATGAGCTTGACTCTATTGCCACC
CAGAGAGGAAGCAGCGTCGGCGATGCTGGAGGTGCAGCTGATAGAGTGCTGAACCAACTGCTGACTGAGATGGATGGCATGAACGCCAAGAAAACTGTCT
TCATCATTGGTGCTACCAACAGGCCAGACATCATCGACCCTGCCCTGCTTAGGCCAGGGCGTCTTGATCAGCTTATCTACATCCCTCTTCCTGATGTCGA
GTCGAGGCACCAGATCTTCAAAGCTTGCCTCAGGAAGTCTCCTCTGGCCAAGGATATTGATCTGAGTGCTCTGGCCAAGTACACCCAAGGGTTCAGCGGT
GCTGATATCACGGAAATTTGCCAGCGTGCTTGCAAATACGCCATCAGGGAGAACATCGAGAAGGACATCGAGAGGGAGAGGAGGAGGAAGGACAACCCTG
AAGC
page-top