Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2025  (registered. 2012)
Contig Information
Length 929 bp
Clones alternative view 59 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 5
Wh_e Seed DPA10 1
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 2
Wh_r Root 3
Wh_yd Spikelet at late flowering 8
Wh_CSEC Callus 1
Wh_DPA20 Seed DPA20 4
Wh_EM Dormant seed with water absorption 3
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 6
Wh_RDr Root of dessiccated seed 1
Wh_SHDr Shoot grown with dessication 1
Wh_V483 Shoot grown under cold condition for 3days 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23Ž 2
WH_XT Roots, 18 day old plants were grown hydroponically 4
WH_XA Root 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226499354|ref|NP_001147027.1|| polyubiquitin containing 7 ubiquitin monomers [Zea mays]
Score 450
Evalue 1.00E-124
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2025
CTTAAGGATACTGCAGTGCCAGCAACGGTTTCAACCAACATAACAAGGGGACTCGATAGTTTTCAAACCAACACATAGGACTGACACGAACGAGAAAACA
GTTCAAATGAACGGCAGGGCACCACCGACCAGACGACCCAGGATAAACCAGCAGGTTGAACGCCAGGGCAATTACTGACCACCGCGGAGGCGGAGCACCA
GGTGGAGGGTGGACTCCTTCTGGATGTTATAGTCCGCGAGGGTGCGGCCATCCTCCAGCTGCTTGCCAGCAAAGATAAGGCGCTGCTGGTCCGGGGGAAT
GCCCTCCTTGTCCTGGATCTTAGCCTTTACGTTATCGATGGTGTCGGAGCTCTCAACCTCCAGAGTGATGGTCTTGCCGGTGAGGGTCTTCACGAAGATC
TGCATGCCACCACGCAGGCGGAGCACCAGGTGGAGGGTGGACTCCTTCTGGATGTTGTAGTCGGCAAGGGTGCGACCATCCTCCAGCTGCTTGCCAGCGA
AGATAAGGCGCTGCTGGTCCGGGGGGATGCCCTCCTTGTCCTGGATCTTGGCCTTGACGTTGTCGATGGTGTCAGAGCTCTCAACCTCCAGAGTGATGGT
CTTGCCTGTGAGGGTCTTCACGAAGATCTGCATGCCGCCACGCAGGCGCAGCACCAGGTGGAGAGTGGACTCCTTCTGGATGTTGTAGTCGGCAAGGGTG
CGGCCGTCCTCCAGCTGCTTGCCGGCGAAGATAAGGCGCTGCTGGTCCGGGGGAATGCCCTCCTTGTCCTGGATCTTGGCCTTGACGTTGTCGATGGTGT
CAGACGACTCCACCTCAAGGGTGATGGTCTTGCCCGTGAGTGTCTTCACAAAGATCTGCATCTTGAGGCGGTGGGGAAGGAGGATTCGACGAGCCTCGGG
TCGATCGGAGACGAGATTAGCTTGGGATT
page-top