Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig20065  (registered. 2012)
Contig Information
Length 1478 bp
Clones alternative view 22 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_r Root 1
Wh_VSCB Liquid cultured tissue 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XA Root 1
WH_XE Seedling, infected with leaf rust 1
WH_XF Seedling, infected with leaf rust 6
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XV Leaves, plant was grown at constant 23℃ 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115458014|ref|NP_001052607.1|| Os04g0382300 [Oryza sativa (japonica cultivar-group)]
Score 729
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig20065
TGACTGCGGAGGCGGAGTGACAGTATTATTAGAATCAGCGGATCCGCATCCGTCGACGCAGCAATTTGGCTTAGAGTTTATCTCTTGCATTTCCCCGCGC
GTAGCAGCAAGCACAAGAGGAGAGATCGCAGGAGGCAGCAGTTTGTTACAGAGCTGTTGGGAGAATCCAGGAGGAAGTCGAAGTACTCCGGTCCGGCCAA
GAAGGGGGAGACAGAGTGGGGGAGAGGGGGCTGAGAGGAGATGGAGACGGACAGCCCGCGGAGCCCGGAGGCGGAGATCGGGCACCGGGTGGAGGACCTG
TGGGAGGTGGCGCAGCCGCAGCTGTCCCCGTCGGAGAAGCTCAACTCCTGCTTCGAGGACATCCCCGTCGCCGCCTTCCCGCGCAACCACCCCTCGCAAG
TGATCGAGATACCTTCGGATGCCAGCCTTTCTGATACTGTTGAGACATTATCCAAGAATAAAATTTTGAGTGCACCCATAAGAAACGTCGATGCTCCAGA
GGATGCTACTTGGATAGACAAATACATCGGTATTGTGGAATTTGCTGGTATTGCAATGTGGTTGCTTCATCAGTCTGATGCTTCAGGTAATGGAACAGCT
GGTTCTGCAGTTGGATCACCTGTGGCCAATCTAGCATCTAGGTTAGGCTCTTTCACATTCAGAAGAACGTCATCTGGCAGGGTAGAAACCACTACTGATT
CAGAATCAGATGAAGCTGCATCAGTGGGTGGAAGCTTTTTTGAAACCCTTACTTCCTCTGAGTTCTACAAGAACACAAAGGTTGGCGATATCTCAGGAAG
CTTCCGGTGGGCACCATTTCTTGCCCTGCAGACATCTGACACATTCCTCACCATGCTGCTTCTTCTATCCAAGTACAGGATGAAGAGCCTCCCAGTGGTG
GATATGGGGGGGAATCAGATTGAGAATATCATTACACAATCTTGCGTTGTGCACATGCTTGCAGAGTGTGTTGGACTTCCTTGGTTTGAAAGCTGGGGAA
CCAAGAAACTCNNNGAACTGGGCCTTCCTCTGATGAAGCCATACAAACTTGTTAAGGTAAATGAAGACCAGCCAGTCCTAAAAGCCTTCCANCTGATGAG
GGAAAAGGGGGTTGGTGGTGTGCCTGTTATTGACACAAATGGAACAAAAGCAATTGGTAACATTAGCATCAGAGATGTCCAATATCTTTTGAGTGCCCCC
AAGATATACAAACAATACAGGACAATCTCAGCCAAGGATTTCCTTACCGCGGTCCGGCACCACCTCCAGGAGCAACACGAAGCGTCGCCGTTGCTGCACG
ACGTGATCACATGCAAAAGAGACGACGTGATCAAGGAAATCATACTGAAGCTGGACTCGACCAAGATCCACAGGANNNACGTGGTCGACGACAAGGGGGA
CACCGAGGGGGTGATCACGCTGAGGGACATAATCTCCAANCTGGTGCACGAGCCACGGCATTACTTTGGGGATTTCTT
page-top