Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig20060  (registered. 2012)
Contig Information
Length 1639 bp
Clones alternative view 18 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 1
Wh_KMP Shoot grown under continuous light 2
Wh_PCDAM Anther at meiosis 1
Wh_RDr Root of dessiccated seed 2
Wh_SHDr Shoot grown with dessication 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 4
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XD Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|29367359|gb|AAO72552.1|| NAC-like protein [Oryza sativa Japonica Group]
Score 380
Evalue 2.00E-103
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig20060
GAGCGTGTGCAAACCCCAGAAGTGCTCATCCCACAAGAAATTGCTCCTCTCCAAGCAATCGCTCCTCCCCAAGCTCAAGATTTTAATGGGACTGGCATGG
TCAGCTATGCTGACGGTGATGTTCCTCTGGACGAGATTTTGCAGGAGCCTGTGTCAGATGTCAGTGCTGACAATACAGGTGAACCTGAAGAGCAGAGTCC
CCTTGATGATCATTTCAGTCTTGCGGATTTGTCTGGATGCCCAAATCAAGATGATGGATATGTACGTCAGGCTGGCCCTATCATGTTTAGTGACCCATCA
AATGGTGATCAGTCATATTATCCAATGAGAACTTATGGTAATCGAAACCATGCCTATCGGGCTCTTAGTGCCGAGGAGTTCTCCGACACAGGAAATGGTA
CCAATGCGTATTCAGGACAGCAGCAAGCTTGTCCTTCAGATGACCAGAACTTGTATTCAGGACTGCAGCAAGCTTGTCCTTCAGATGAGCAGAACTTGTA
TTTGCCAACCAATGGTCTGCCATTTCCACAGCAAATGGATGACAACGCGCCGTTTTATGAGGCATCAAGCGATCACAAATGGGAAAATGGAAAGGATGAT
TATGTAAATGTGGATGACATTTCTCTCTTTGAGGATGATGATATCATGGCTCTCTTAAATGCCTCAGACAACGATTTCAGTTTAGATCTTTTGGGCCCAG
TTGACGGATCTAATTCTCAACTTCCAGCAGCATCGAACTTTGACCAAAAGGATGAAGCAAAGGCTCAATATGGCGCGTCTTCGTCTGGTTCCCGTGAGAA
CCTTTATCCAGACACCATGGTTCCAGATGTGCCAATGGATGACAATGCTGGCAAAAGATACTTCACAAACATGCTGGGTTCATACCCAGCCCCACCTGCA
ATGGCTTCTGAATTCCCGCCAACCACAGGAAAATCCATCGCTGCGCTCAGCGGGCCTAGTCAGATTCGTGTCACGGCGGGCATCGTCCAGCTCGGCGACC
ACAGTTTCACCGGCAACGAGGGCAGCTGGCCCCTGCAGAAGAACGGAGTCTTCAACCTGCTCCTTTCTTTCACCGTGGAGAGCAACGTGTCAACGAAGTC
CATTACTTTCGACGACGAGCCAGCTGCTACACGGGTGAGCACCGTCCCGACGGTGCTGCGCGGCGGCCTATACCTCTTCTTTGTCTCGGCCATGATCCTC
ATGTTGAGTTTCAAAGTAGGGTCCTGCATCTACAGCAGGTAAGTTAAGAGCCTGCCCTTGGGGCCGTTCTTATTTTGGTTTAGCGGAACTATACATGGCG
CCCCCTCGACGACGGCGTGGGAGCAAACGACTCGGAAGACAGTTTTACTTTTACGCACTTAGTTTGTCATGTCATACGATCCTGACTTGGTGAAAGGTAT
AGTAAAGCAATAAGCTCTCGAACTGGAGAAAGCCCGGTCGCTTTGCACGCGCTCGGTGCTGGGACCTTTGTGCTTCATCCTAGGACCTGTAATTTATTCT
GTTTATTTGGTCGCTGCTCAGAGTGTTTGGAAACCCGAAAGATGTAACATTGATTATAAACATGGTATCTCTTGGTTGTTTGGCGTGTTGATTTTCCGTC
TCTTAGCACCAATGCTGGATGCGGCCGGCAAAAAAAAAA
page-top