Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig20049  (registered. 2012)
Contig Information
Length 1781 bp
Clones alternative view 263 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_V4816 Shoot grown under cold condition for 16days 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23Ž 6
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 33
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 8
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 7
WH_XR Roots, 18 day old plants were grown hydroponically 4
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 8
WH_XT Roots, 18 day old plants were grown hydroponically 8
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 5
WH_XD Root, treated at 50 microM Al for 6h 10
WH_XE Seedling, infected with leaf rust 37
WH_XF Seedling, infected with leaf rust 57
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 14
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 44
WH_XV Leaves, plant was grown at constant 23Ž 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 9
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242093606|ref|XP_002437293.1|| hypothetical protein SORBIDRAFT_10g024350 [Sorghum bicolor]
Score 406
Evalue 4.00E-111
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig20049
TTTTTTTTTTGACGAATGCTGAATCAAGTTCAGAATTTTCAGAGCTTGAATTATTACTGCGAGTGTGGCTCAACGGACAGGCACTACACCGAGCAAAGAC
AAAATTCCTCAGGAATGAAACACGGCAGTTCTTCAAATCTAACAGACTGCAACAACGCGCCCAAGGGCGTGTGAAGTATTGTCAACCCGCCCATTGTAGC
ACGTGTGTCGCCCAGGGCATAAGGGGCATGATGACTTGGCCTCATCCTCTCCTTCCTCCGGCTTAACACCGGCGGTCTGTTCAGGGTTCCAAACTCATAG
TGGCAACTAAACACGAGGGTTGCGCTCGTTGCGAGACTTAACCCAACACCTTACGGCACGAGCTGACGACAGCCATGCACCACCTGTGTCCGCGTTCCCG
AGGGCACCCCTCTCTTTCAAGAGGATTCGCGGCATGTCAAGCCCTGGCCTCGTGCCGAATTCGGCACGAGGATGACAAACAATTCAAGGTTCTCGAGGTA
CCTCCGATCGTGCAAGAGCTGGTGGGCGCCGGCGTGCAGGAGCCACCGAGCCAGTACGTGCTTCCTGAGCAAGACCGTCCCGCCGCGGCGGTCTCCGAGA
TGCCCGAGCCCATCCCCATCATCGACCTCAGCCGGCTGTCTGCCGGCAGCGCCGAAGAGTTCGACAAGCTGCGGTCCGCCTTGGAGAACTGGGACCTCTT
CCTGGCTGTTGGACATGGAATGGAGCCTAGCTTTCTTGCCGAGGCGATGAAGGCCACGAGAGAGTTCTTCAACCTCCCACTGGAAGAGAAACAGAAGTAC
TCAAACATTGTCGACGGCGAGAAGCTGGGCATGGATGGATACGGTAACGACATGGTCGTGAAAGAGAATCAGGTCCTTGACTGGAACGACCGGCTCAATC
TCCTAGTGGAACCCGAGGCCCTAAGAACCTACAGACTGTGGCCAACACAACCCCCTTCTTTCAGAGACATCCTGTCTGAGTACACGGTCAGGTGCAAAGC
GGCGGCTAACCTTGTCTTTCGAAACATGGCCAAGATACTCAATTTACAAGAGGAACACCTGGTAAACATGATCGGGGAGAACTCCATCACCCAAGCTATA
TTCAACTATTACCCTCAGTGTCCAAGGCCGGACCACGTCTTGGGCCTCAAGGCCCATACCGATGGCTCCATAATCACAGTCAACTTCGCCGATGCTGAGG
GGCTCCAGCTTCAGAGAAACGGCGTCTGGTACAACGTGCCCATCGTTCCAAATGCATTGATTATGAACGTAGGGGATATAATGGAGATTTTGAGCAATGG
GTTCTTCAAGAGCCTGGTGCATAGGGTTGTGACCAACGCGGAGAAAGAGCGCTTGTCGTTGGTGCTGGTCTATACATTGGAGCTAGAGACAGAGCTTGAG
CCGGTGTCAGACCTGGTGGATGACAAGAGACCTGCACGATACATGAAGATCAAGCTCCACGACTACATGGAAAAATATCATGACACTTATGCCACAGGGA
CACTAGCCATCGACGGCGTGAAGATCTGAATATGATTCTGATGTGTACAAGTCCGCTAATGAAGAACTATGCATGGTGAAGTATCTTCCGTCGACCAGTT
TGTAACGAGTTTATATTTTTCATGTACCCTTTTCCCCAATTTTTGTGTGTGTACTCCTTCATGTAAAATGTTCGGCAGCTTGTGTGGCTGCATGAAACAT
TAAAATAAAATGTATCTGCTGTGTGCAACATGCAGATGCAAAGGATGGAATAAAACTTATCGGTCGTGTGCAAAAAAAAAA
page-top