Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig20014  (registered. 2012)
Contig Information
Length 875 bp
Clones alternative view 24 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 5
Wh_CSEC Callus 1
Wh_EM Dormant seed with water absorption 1
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_SHDr Shoot grown with dessication 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 4
WH_XE Seedling, infected with leaf rust 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|195611428|gb|ACG27544.1|| peroxisomal membrane protein PMP22 [Zea mays]
Score 333
Evalue 1.00E-89
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig20014
GAAAGGGACTCTTCACATTGACATACTCACATACTTAGTTGAAACATTCACTCTAGGTTCTCGATGCTCGAGGGGTTCACATAGAAACATAAATACAAAC
TGAGTGATAAAAATGAACTGAGAAAATCACTAGTGGATACTTAATTAGCTAGAAATACAATGTAGCACTAGCCCCTTCCTTCCATCCTTCTTTTATGCAT
TCTTACTAGCGCCGGCAATGGATCTTGCTGCTTTCAGGTTCAGAAACACTGCCCAGCATGATGCAATGGAGCTGGCGAAAAGAACTCGGAGCTGGAGTGG
CATGTACTCATAGTTGATCCAGCTAACTATTGGCCAGAACTTCCAAGCTGTCAATTGGATGTTTGCAAAGTCCTTCTTGACCTTGCTCTTTACTTGCCCG
AATGGCCTCCCTTCAACTACCAGACCGTAGTACATCATGAACATCATATTGTTCCATGGTGATACAGTTAGCTGCTCCACTATGACCTTCTTGGCTGTAG
TTTCTTTTCCTTTCTTCTGTCCCTTGAAAATCTTGTCCATAAGCTTGTGGAAAAAATGACCGAATGGTCCTGCGTATGCAAATCCATAGAGCATTATGAG
GAGGAGCCTCCTGAGCTGGAGCTTCTTGACGCCGGAGATCTTCTGGGCGACGGCGTCGCTGCAGCCGGCCAGCACCCCGGAGGTGATGGCCTTGGTGCGG
AGAGGGTGCTTGGAGAGCTGTCTCATGTACGCCTGCCCCGCCATCGCCGCCACCTCAGACATCGCGCGCGGAGAGATGGATCTGATCCCGGCGCTTTGTG
CGAGCGAATCAGCTGCTCCTCGATCTTCTTCCTCCTCCGACTCAGACCCCCAGCGCGTGCAGCGTGCTGATTTAT
page-top