Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig19994  (registered. 2012)
Contig Information
Length 1693 bp
Clones alternative view 120 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 12
Wh_dL Crown of seedling 2
Wh_e Seed DPA10 4
Wh_f Spike at flowering date 4
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 7
Wh_r Root 5
Wh_yd Spikelet at late flowering 8
Wh_CSEC Callus 7
Wh_DPA20 Seed DPA20 3
Wh_EM Dormant seed with water absorption 3
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 3
Wh_SHC Shoot grown with cold treatment 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 3
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23Ž 3
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 3
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 7
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XA Root 1
WH_XB Root 3
WH_XC Root, treated at 50 microM Al for 6h 7
WH_XD Root, treated at 50 microM Al for 6h 5
WH_XF Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|110270498|gb|ABG57075.1|| heat shock protein 90 [Triticum aestivum]
Score 982
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig19994
TTTTTTTTTTATAGAAATATAGCTAACATATAATAGAACCAACAATAACGAACTGTTCCACGAGTACCACAAACAGCTAGCCGCGCTTAATGTTTGGCCA
GCCAAAAGACAAAACCGATACAGCGACCATCCAACGTCGACACTAAAGATAAAAACAACTAGGCGGTGCAGGGCATGAACATCCGACGACAGGCAGACTT
GGCGCTTAGTCGACCTCCTCCATCTTGCTCTCACCAGCGTCGTCCTCCAGGGGCGGCATGTCGGTGTCGTTCTCAGGCGCCTCATCGTCCTCGTCAATGC
TCAGGCCAAGCTTGAGCATGCGGTGGATCCTGGTGCCGAAGGTGTTGGGGTCCTCCAGGCTGAAGCCGGAGGTGAGCAGGGAGGTCTCGAAGAGCAGCAT
CACCAGGTCCTTGACTGACTTGTCGTTCTTGTCGGCGTCGGCGCGCTTGCGGAGCTCGTCCATGATGGCGTTCTCAGGGTTGATCTCCATGGTCTTCTTG
CTTGACATGTAGCCAGCCATGCTCGAGTCCCTCAAGGCCTGGGCCTTCATGATCCTCTCCATGTTGGCGGTCCACCCATACTCGCCAGTCACCAGACAGC
AAGGGGAGTCCACAACACGGTCAGAGACGATGACCTTCTCCACCTTGTCGCCCAGCACCTCCTTGATGACCTTGCACAGCCCCTCGAACTTCTCCTTGAG
CTCCTCCTGCTTCTTCTTCTCGTCCTCGCTCTCATCGAGCTTCAGACCCTCCTTGGTGGCAGAGACAAGCTTCTTGCCCTCAAACTCCTTGAGCTGACCA
ATGGCATACTCATCAATGGCGTCAACCATGTAGATGACCTCATAGCCCTTCTTCTTCAGCTTCTCAAGGAAGGGAGAGTTCTCCACAGCCTTCTTGCTCT
CACCGGTGATGTAGTAGATCTCGTTCTGTCCCTCCTTCATCCTAGTCACATAGTCCTTGAGGCTCGTCAGCTCATCACCACTCTTGGTGGAGTGGTACCT
CAGAAGCTCAGCAATCTTGGTCCTGTTCTGGGAGTCCTCGTGGATGCCAAGCTTGAGGTTCTTGGAGAAGGCCTCGTAGAACTTGTTGTAGTCCTCCTTG
TTCTCAGCAATCTCAAAGAAGAGCTCAATGCACTTCTTGACAAGGTTCTTCCTGATGACCTTGAGGATCTTGTTCTGCTGGAGGGTCTCACGGGAGATGT
TCAGGGGAAGGTCCTCTGAATCAACAATGCCCTTGACAAAGCTCAGGTACTCAGGGATCAACTCCTCACAGTTGTCCATGATGAAGACACGGCGCACATA
CAGCTTGATGTTGTTGGCCTTCTTCTTGTTGTCGAAGAGGTCAAAGGGGGCCCTCTTGGGCACAAACAGGACAGCCTTGAACTCAAGCTGGCCCTCAACA
GAGAAGTGCTTGACAGCCAAATGCTCCTCCCAGTCATTGGTCAAGCTCTTGTAGAAAGCAGCATACTCTTCCTTGTTGATCTCCTCTGGCTTCCTCATCC
AGATAGGCTTCTGCTTGTTGACCAAGTTCCACTCATGAGAGACTTCCTTGATCTTCTTTTTCTTCTTTTCCTTCTCTTCCTTCTCCTCATCAACATCCTC
AACCTTGACCTCCTCAGTATCCTTCTTCTCCTCCTCATCTTCATCGTCAGAAATTTCCTTCTCAGTGGTCTTCTCGGTCCACAGGGAGATGGG
page-top