Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig19969  (registered. 2012)
Contig Information
Length 1909 bp
Clones alternative view 224 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_f Spike at flowering date 11
Wh_h Spike at heading date 2
Wh_yd Spikelet at late flowering 7
Wh_SH - 2
Wh_DPA20 Seed DPA20 1
Wh_EM Dormant seed with water absorption 4
Wh_EMI Dormant seed with water absorption after breaking 3
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 4
Wh_KMV Shoot grown with continuous light after cold treatment 17
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 4
Wh_RDr Root of dessiccated seed 4
Wh_VABA Shoot with ABA treatment 8
Wh_VHS Shoot with heat shock treatment 6
Wh_VSCB Liquid cultured tissue 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 21
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 5
WH_XN Leaves, plant was grown at constant 23Ž 7
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 4
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 16
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 30
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_SP 2
WH_XA Root 7
WH_XB Root 5
WH_XC Root, treated at 50 microM Al for 6h 6
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XE Seedling, infected with leaf rust 1
WH_XF Seedling, infected with leaf rust 3
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 16
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XV Leaves, plant was grown at constant 23Ž 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 5
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 10
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|132087|sp|P00871.2|RBS1_WHEAT|RBS1_WHEAT RecName: Full=Ribulose bisphosphate carboxylase small chain PWS4.3,"
Score 356
Evalue 7.00E-96
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig19969
ACTAGCTGTGAGGCATATCCATTGCAGTGCCAAATAAAGAAACTTTTCCTTTTTTGCGGGAAAATTTTTTTAATAACAGCAAGACAATGGTCCGCGTGTT
GTATATAACAAATATTACACAGGTTTTGCATATGGATAGCCGGTGTATATAGACCTATGAGGAATTATGTATGCATGCTCGAGAACATAGGTTCCTACAT
ACATACACAAATCATATAGAACAAAAGGTATGCTCCGGTCGGAAAGCAGAGTCGTGCAACAGAGGTCGTGGACAAAAGTGAAATTCACAAAAGATCTTCA
TATGAGATAGGCCATTGTTTCAACTCATAGTTTAGGCCTTGCCGGACTCCTCGCAACCCGGTGGCCTGAAGGCGATGAAGCTGACGCACTGCACCTGGCG
CAGGTTGTCGAAGCCGATGACGCGGACATAGGCGTCAGGGTACTCCTTCTTGACCTCCTCCACCTCGTTGAGCACCTGTGTGGCGTCGGTGCACCCGAAC
ATAGGCAGCTTCCACATTGTCCAGTATCGACCGTCGTAGTACCCGGGGGAGCTGTTGTGCTCACGGAAGACGAAGCCAACCTTGCTGAACTCGAGGCAGG
GCACCCACTTGGAGCGGATCAGGTAGTCGACCTGCTTCAGGAGGGCTTCCGTGGAGAGGGGTGGCAAGTAAGACAGGGTCTCGAACTTCTTGATGCCCTC
AATTGGCCACACCTGCATGCACCTGATCCTTCCGCCGTTGCTGACGCTGCCGAGGCTGCCGCTGGAGCGGCGGCTGACGGGCAGGCCGGCTGTGGACTTG
AGCCCCTGGAAGGGTGCGACGGTGGTAGCCGACGAAGCCATCACGGCGGGGGCCATGGTATTTGTATTATCGGAGGAGAGGAGGATGCCCGGTTAAGGGT
AATGACTTCAAACATGGCCAGCTCCTATAGTGTGACGGGCGGTGTGTACAAGGCCCGGGAACGGATTCACCGCCGTATGGCTGACCGGCGATTACTAGCG
ATTCCTGCTTCATGCAGGCGAGTTGCAGCCTGCAATCCGAACTGAGGACGGGTTTTTGGAGTTAGCTCACCCTCGCGAGATCGCGACCCTTTGTCCCGCC
CATTGTAGCACGTGTGTCGCCCAGGGCATAAGGGGCATGATGACTTGGCCCCTCGTGCCGAATTCGGCACGAGGCCGCAGCTTCCCATTCCTCGCCGCCG
CCGCCGCTCCGTACCCGCTCGAAGCCGACCCGACCATGGCGGACGTCGACGTTGACACGGAGGTGGCCGCGGGCGCGCAGCCGAAGAAGAGGACGTTCCG
CAAGTTCAGCTACCGTGGCGTGGATCTCGATGCCCTCCTCGACATGTCCACTGACGACCTTGTCCAGATGTTCCCCGCTCGCGCCCGCAGAAGGTTCAAG
AGGGGTCTCAAGAGGAAGCCCATGGCGCTCGTCAAGAAGCTGCGCAAGGCGAAAAAGGATGCTCCTGCTGGTGAGAAGCCTGAGCCAGTGAGGACACATC
TCCGCAACATGATCATTGTCCCTGAGATGATTGGCAGCCTTATCGGTGTCTACAATGGCAAGACCTTCAACCAGGTTGAGATTAAGCCTGAGATGATTGG
CCATTACCTTGCAGAGTTCTCTATCTCCTACAAGCCAGTGAAGCACGGTAGGCCCGGTATCGGTGCCACACACTCTTCCCGGTTCATCCCTCTTAAATGA
GTTGTGCCGCTTTCTACTTTGAAAGAAATCAGTACGGACCATCTGATGGCATGTCCATCGAGCTGTCTCCCTTGTTTTGAACCAGTTATATATCTAGTAT
TTGGTTCTGTTTAGCTATATAATTTCGTTATGCACAATGAGCTGTTCTATCTAAATGCTGTGAGAATCTTATTTCCGTTGTGAAGGTTCATTTTGATTCA
AAAAAAAAA
page-top