Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig19962  (registered. 2012)
Contig Information
Length 1146 bp
Clones alternative view 25 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 2
Wh_h Spike at heading date 2
Wh_yd Spikelet at late flowering 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_SHC Shoot grown with cold treatment 2
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VSCB Liquid cultured tissue 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 1
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226502548|ref|NP_001148666.1|| ran-binding protein 1 [Zea mays]
Score 369
Evalue 4.00E-100
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig19962
TTTTTTTTTTAAAATAATATAGCAAGTGATTTATAGAAGTTGTATGCAATCCATAACCAGCACATGCAACTCAAATACCCACAATTCAAACCCAAAATGT
TCCAAACTCAATACTCATGGACTACATTTCGAGTTCTTGACAAAAGCAAGACAACACCATCCAAAAGCCATGCGAGCAGATATTTTACATAACAATAAAT
ACTCAGACGCGTGAACACCCAGTGGGGGTGAAGATGGACTCTGCTCAAGACACCTTCTGACTGTCTCAAAAAGTTCTCAGCATATTTCATCGTCAACGAC
TACCAACTTCCGTCAACAGGAAGGACCGACAAACTGACTCTTGCCACCGAGCAATGCTCAGCGGTACCATTGTGACGGGCGTTGCTCTGCCCACTACTCT
GAGGGGGCTGTCGCGGCTTTGGTTTCTGTCTCCTTGCTAGCATCAGTTGATTCCTCCTTAGCTGCGCTTTCCTCAGGTTTGCTTTCGCTTACACTAAGTT
TCTCCAGCAGTCCAGCTGCGGAAGAACCTTCTTCGCTTTCACCGCCTTCATTCTTTGCAAGCGACTCAGCGATCTCATCAACTAAGTCTTTAAACTTCTT
GCAATTCTCAACGGTGCCAAACCGGATGGCAAACATCTCATCCTTAAGTTCTCCGTCAGCAAAGTCTGCCGCGTGCCAGACACAGGACTTGTCGCTGCCG
GCGTGTTCCTGCATCTTCGTGGTCGAGATCACTAGGTGATTGGCGCAGATCTTAAGTGTCTTGGCCTGGCGCATAACAAGGCGGACCTTGCCGTTCTCCT
TGTGCTTGAGCAGCTTGACGGTGCCCGTGCCCCTCTCCTTCCACTGGTTCCCATCCTTGTCGAACCTGTATAGCTTCGCCTTCATGTCGAGGAGAGAGTC
CTCGTCCTCCTCGCCGGTGGTGACGGCGACCTCCTCGAGCCGCACGATGGGGGCGACCTGGGCACCGGTGTCCTCCTCCTCGCCGGCAGCGGCCGCGGCG
GCGGAGTCCTCGCCTTCCTCCTCCGCGACGGGGCGCTCCACGACGGGCTCCTTGTCCGCCATCGGAAGGGTTGGGCGGCGGCGCGCTTGCTACTTCCGAG
TCGACGCGGCGGCGAGAGGGGGGGACGAAGAGAGACGCCGAGGGAA
page-top