Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1996  (registered. 2012)
Contig Information
Length 1591 bp
Clones alternative view 56 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_e Seed DPA10 1
Wh_h Spike at heading date 5
Wh_oh Pistil at heading date 1
Wh_yd Spikelet at late flowering 2
Wh_EM Dormant seed with water absorption 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 3
Wh_PCDAM Anther at meiosis 1
Wh_SHDr Shoot grown with dessication 1
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VSCB Liquid cultured tissue 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 9
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 5
WH_XN Leaves, plant was grown at constant 23 7
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 3
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 4
WH_XD Root, treated at 50 microM Al for 6h 3
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig1996
TTCGGCACGAGGGAGAGAACTAGTCTCGTTCTCCTCTGTGGCACGCAACCTTTGTCCCCTCTAGATATAGAACAACACGCCTCGTCCACCCATACCTCTA
GAAGTCTAGATCTAGGCCTGACCCGTAGTTTTCTGATCGTGTTCGCTTCGATCTCGGGGTAAGCTGAGTTCGGCGTCCATGATTTGTTCCTATCACCCGT
TTGTTATCTGATTCTCAGGTTTCTCCTTCTGATCGGCGAGTTGGGGCTTGCGGCGATCTTGGAGCATAGACGGGAGGCAAGCTGGATCTGCGCACGGAAG
CTTCCGATCTGACCGGCTGGCGTCTCAGATCTGCTGCTGGTCTGATGCTAAACGGCGGATCTAGATGTTCCCGGCGGTCTCAGTATGTTGCAGCGGCGGG
CCCGGAGGGGCTCTCTCCGGCGAGTACGTGGGATCCCGTCTGCTCCTCCACCCCGTGCGACGACGGCCGACGGCTCTTTGTGTTGATAATTATTCGATGC
TATGTCGATAATTATTAGATCTAAGAGATCGGAGGTGACGTAAGGTAAGAAGATGTAGCAAGCGAGGTGCTTGTGGAGAGGTCGGAGGAGAGTGAAAAAA
AAGAGATGTGAACATCTAGAGGCCTTTGCCATGTTGGGTGCGCTCGCATGGCAGGCCGCCACCATAATAAAGATGTTTTTTTGTCTCGGGGGGAGATCGC
ACGGGGGTTATCTTGTTTTAGCCCCGGGTTCTCCCCCCTGTGTGCTGGTGTGCTCCTTTGTCCGCACCCCTCGTCCGATCCGACTACATGGCACAACGTT
CTACCGTCGCAAATCGTTCATGGAGCTACCCTCGAAAGACCAAAGGTACAATTGATAATTTACATACCGCTGAACCGTACATAAGCTTTGACAAAGTACC
TATTTCATTCAAAAATTATCTTGAATTCATTCAGAAGTTACTTGCATTAATATAGAGAAATTGTACAACATCATCACAAATCTGTACTCGACAACTACAT
GCAGTCCAGCATAATCAAATCTTGCACATATGTTCTTCACTCAAAATTGTGTTTATTTGTATGATATTCTGAACTAAATTTAAGTATTTCTCTGTATGGA
AGGATCATATTATCCTGTAAGAACATTTTAGACCCTATTTCTTGTGGTCAGCTGCTTCATAATGTAAGATGTCTTATGTTAGAAATAATTTATGTAGCTT
GAACAGCTGTAAGTGGTCCGTGTATTACCCAAATGAAGCTTACAGTACAATTATCGCTGCACCGTCGAATGGATGTTTCTCTCGTTGGAGCTTCGATGGC
TGAAGAGACGTGAAGAGCTATTTGATTCTGGACAAATCTGTGACCGTGAATTTCCACCGGCAGGATCGTCAGAAGTACCTACTAATCTGGAAAATCATTT
ATTAAGTCAGATGTACCTACTAATCTGGAAAATCATTTATTAAGTCAGATGTACCTACTAATCTGGAAAATCATTTATTAAGTCAGATGTACCTACTAAT
CTGGAAAATCATTTATTAAGTCAGATGTACCTACTAATCTGGAAAATCATTCATTAAGTCGCAATTTGAACAGTTATGCTACTGTTGTAGC
page-top