Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1995  (registered. 2012)
Contig Information
Length 845 bp
Clones alternative view 49 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 10
Wh_f Spike at flowering date 6
Wh_h Spike at heading date 6
Wh_CSEC Callus 1
Wh_DPA20 Seed DPA20 3
Wh_EMI Dormant seed with water absorption after breaking 5
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 3
WH_XN Leaves, plant was grown at constant 23 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 4
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 6
WH_CA 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig1995
GGAATTCGGCACGAGGAAGAAAAGTGTCGCCCGGCTCCTTGGCCCTCCTCCTCCGGCGGTGCTGCCGTCGTGAGCGAGCATGGGGAAGGTAGCCAGGTCT
CTCCTCCGTCAAGTAGGTGTAAGATTAGGTTTAGGACTGAGTCTAGGTTTGTCTCTGTGGCGTTTGACGTGATGTCGAGTTGGAGCTTCGTCCAGGCGTC
CTCGAGCAGCGCCTGGCGGCTGGTTCTCTCCCGAGGTGAGCTTCCATGGTGGAAGTTGACAGCGGGTGGTAGATCTGGTGATAGCTTCCCTAATAAGCTC
GAATCTTTCCCTGATCTGGAGGATCTCCGTCGCCTTGTTCCATTTGTTCGTCGCTGTCGTGGAGATGGGGACAGAAAGTGGAAGAGGTGGAGCGCAAGTT
TGTTTCGATTGGGTTTGTGCATATTCTCATCGGTGCTTGGAGTGGAGCTACGGCGCCCACTGGAGCTGCCGGTCTCCGCCGCCTTCCCGGTGACATTTTT
GGCCGAAGGGCGGCCTGGTGAAGCCATGCTGGCTTCGTTTCTTCCTCCTGGCTTGATGCCATTTGAGAGGCAGCTGTTCAACTTCAACATGGAGTCCTCT
TCTTCCATCTTTGTCCGGAGATGGAGTAGTGGCGGTCCAGTGATCTCAAGTGGCCACGTCCCCGGTGATGGCCGGACTGGATCTACGCTGGAGTTGAGTA
TTGGACCCGATTGTAATCTTAATCATCAGGATGGGGTCCTCCTTGTTAGTTTCAATGACTATGATGTAATTTCCTTTTCTTTTCAGTCCTGGTATGAGCT
CTGTACTGCAGCCGCTGATAGTTAATGGATGCTCTGGGTCCTTCC
page-top