Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig19922  (registered. 2012)
Contig Information
Length 813 bp
Clones alternative view 13 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 5
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XE Seedling, infected with leaf rust 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|171474661|gb|ACB47288.1|| UDP-glucoronosyl/UDP-glucosyl transferase [Triticum aestivum]
Score 393
Evalue 1.00E-107
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig19922
AGACTGTGTAGTTGTTATGTGGACTGCCATGAAAGAGCGTACATAATAGAGAGGATAATTGATATTCCCTTCATTTGGATCATCTATAATCTCTAAATAA
TCACCTGTGAGCCTGGTACAAAATTCTATATGATGATATATGTACTCTAGGATGTTTCACTTCATGTTTACACCGAAAAAGCGAGCTTAGGTAATCTCTA
TCAACCACATGCATTCGTCTTGTTTTCCATTTCTTGAATTAACAGCCTTACGTTGTTGTAAGAAGAACCTTCCTCGTCGAAAGCCCTCCTTGCCTTAATG
GCGCAGTCTTCTGCTCTCATTCTCAACTCCTCTGTAGCCTCCCCTTCACCCATCAGGGTGTTCACTGCTGTCTCCACAGCATCTCTGGTAACCATAACCT
CTTGTTGTTCACTTCCCCACTGTGTAACTCCTTGCACTCCAACCTCTACCCCAAGTTTCAGCACATCCACCACCAGCTTCTCATTCAGAAACTGCTCTGC
AAAGTGTGGCCATGTGATCATGGGCACACCTGCACAGATGCCCTCTATTGTTGAGTTCCACCCACAGTGTGTCACAAATCCTCCAATGGCTTGGTGCCAC
AGGATCATCACCTGTGGCGCCCAGCCCCTTATGATCATGCCTCTGTCTTTGACACGCTCCTCGAACCCATCTGCGAGCCATTCCTCGACTTCTGGAAACT
TAGGTCCTGCTTTGATCACCCAAATAAACGGTTTCTTNNNNNNNTCGAGTCCCAGTCCCAGCTCAACAATTTGTTGTGGTGTAGTGCAAGCAAGGCTTCC
AAAACTCACAAAG
page-top