Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig19918  (registered. 2012)
Contig Information
Length 1040 bp
Clones alternative view 13 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 2
Wh_VWD Shoot grown with dessication 2
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 6
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218194147|gb|EEC76574.1|| hypothetical protein OsI_14406 [Oryza sativa Indica Group]
Score 431
Evalue 7.00E-119
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig19918
TATTCGTGGCGCATGACAATTGGCCAAGACTACATATAAGCTTTGGTTTAATGTCATAGGCTCACAACCATCTAGATTTTCTATACATTCCGCAATTTAA
TCCGTGTGAATCAGGTACAATTGCAAATACATATCTACAGAAAATCATACTACAACATAGAAGCAACAAGCAGTTCCTTGCAGACTTGGTAATTCCATTT
GCTCACTTGATTACCAAACATGAATGGCCAACTCTGCATCTCGGTGCTCCTACCTTCAATTATCCTGTTCATGAATCTGGAAGTGTGATCAGCCGAGTTT
TTGAGTCGTATACCATCACCGTTTTGCAATTTGCGCATTTCACATTGTTCGTTGCTCCACCGCTCTCGATCGACAGTATCGTCCCGTAGAAGGAAAGATT
TTCAGTGCCGCAATTCGGACACGGCCCCTTCAGGATTAAGACATCATTTATTATGGCCTTGGTTACCACTTGGGCCGTAACCAATATCAGAGGCAAAGCG
GCAAAATATGTGAATATGAATCCGAAGGGCTCCGGAAACTGGAATACATTGACCTCAAAGCCAGTCAGCTCATCGATGAAAAAGAACAGTCCTAGAGCAA
CAATAGTCGCTGGAACATTGAGCAGGAACATCTTCAAGTAGTCAACGGTCAGATCACTGTAAACCTTCCGACTCCGTAGACTGCACCTGGGGCCTTCCGT
CACGATGTCGCTTCCATCTTGCTTGAGTCTGAGCTTGAGCTCGTCGAATTCGGCGTCGGACATGATGGGGTTGCCGGCGATGTAGGCCATGGAGGCTTCC
AGCAGCCTTTGCTCATCGGCGCTTAGCATGACGACGCTGCTGCCTTCCCACATGAGCTCCTCCTTGAGGTTGTCGAACTCCTCGTTGGACATGATGGCCT
TCTGGTCGTAGTAGAAGGACTGCAGGGCTCGTAGGAACTCCTGCTCCATCTCCCCGATGGTCTTCTTCTTCTTGCCGTCGATGCTGCAGTAGGGGAGCAC
GTTGCCGTCCACCACCTCCTCCTCCCCTCGTGCCGAATTC
page-top