Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1979  (registered. 2012)
Contig Information
Length 977 bp
Clones alternative view 542 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 29
Wh_dL Crown of seedling 14
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 24
Wh_h Spike at heading date 28
Wh_oh Pistil at heading date 20
Wh_r Root 19
Wh_yd Spikelet at late flowering 33
Wh_CSEC Callus 22
Wh_DPA20 Seed DPA20 12
Wh_EM Dormant seed with water absorption 4
Wh_EMI Dormant seed with water absorption after breaking 5
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 11
Wh_KMP Shoot grown under continuous light 33
Wh_KMV Shoot grown with continuous light after cold treatment 10
Wh_MS Seed DPA5 of DT3DL CS wheat 3
Wh_OKCS Seed DPA5 29
Wh_PCDAM Anther at meiosis 19
Wh_RDr Root of dessiccated seed 10
Wh_SHC Shoot grown with cold treatment 4
Wh_SHDr Shoot grown with dessication 10
Wh_V4816 Shoot grown under cold condition for 16days 13
Wh_V483 Shoot grown under cold condition for 3days 26
Wh_VABA Shoot with ABA treatment 17
Wh_VHS Shoot with heat shock treatment 7
Wh_VWD Shoot grown with dessication 16
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 5
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 11
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 19
WH_XN Leaves, plant was grown at constant 23Ž 6
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 6
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 8
WH_XR Roots, 18 day old plants were grown hydroponically 9
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 15
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_SP 10
WH_XB Root 8
WH_XD Root, treated at 50 microM Al for 6h 13
WH_XE Seedling, infected with leaf rust 2
WH_XF Seedling, infected with leaf rust 1
WH_XV Leaves, plant was grown at constant 23Ž 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|13925731|gb|AAK49426.1|AF262982_1|AF262982_1 cyclophilin A-1 [Triticum aestivum]
Score 360
Evalue 1.00E-97
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1979
CGAATCGGCACGAAAATCGAGTAGATAACACTAGAAANNNNNNNGGGCTCCAACACATTGGAGTCAGGAGCACCAGACAAAGAAAGAACGCGACAAACAG
GTACTGAATCCAACGTTTTTTTTTTACGGATAATTCATAGCGGAGTTCATCTCATTCAAACGGTAAGATAGCAGCAGACACAGGAAGATAACCAAGGCCG
CCGGACGCAGATCCAGCGGCCCAAAGAGTCCACCTAAAACCCTCCTAAACCAACCACGGAGATCTCATCGGACGGACCAGGGGAAGACACGACACACGAC
TCTCTTATTTAGATCGACGACACGACACGGGACACACGGGGCGATGACGACGACGGCGACCGGCGGGCGGGCGGATCTAGAGCTGGCCGCAGTCGGCGAT
GACGACCTGCTTGGAGCAGGTGCCGCTGCGGGAGCCCACCTTCTCGATGTTCTTGACGACGTCCATGCCCTCGACGACCTCGCCGAAGACCACGTGCTTG
CCGTCGAGCCAATTGCAGGGGACGGTGCAGATGAAGAACTGGGAGCCGTTGGTGTTGGGCCCGGCGTTGGCCATGGAGAGGATCCCGGGCTTGGTGTGCT
TGTGGACGAACTTCTCGTCGGCGAACTTCTCGCCGTAGATGGACTCGCCTCCGGTGCCGTTGCCCCTGGTGAAGTCGCCGCCCTGGCACATGAAGTCGGG
GATCACGCGGTGGAAGGCGCTGCCCTTGTAGTGCAGCGGCTTGCCGCTCTTGCCGACGCCCTTCTCGCCGGTGCAGAGCGCGCGGAAGTTCTCCACCGTC
CGCGGCACCGCGTCCTTGTACAGCTCCATCACGATGCGCCCCGCCGGCGCGCCGCCGACGGTCATGTCGAAGAACACCCTCGGGTTGGCCATCTCGCTCG
CCGGGATCGGGGATGAGGGCTAGGGTTTTGAGATGGGGATTTCTGTGCGGATTGGATTACCCTCGTGCCGATTCGGC
page-top