Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig19781  (registered. 2012)
Contig Information
Length 924 bp
Clones alternative view 13 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 2
Wh_EM Dormant seed with water absorption 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 3
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig19781
ATTGCAGCGGCAGCGTGTTCTGCGACAGCGGAGGCAACGACTCTCAGTGTGACAACGGTAAATCAACGGACGTTACTTTCCTCTGCCTCCCTTGAGAGTC
GCACATGCAAAGCTCCACCCGGCTCCTTTGCCCTCCTCCTCCGGCGGTGCTGCCGTCGCGAGCGAGCTTGGGAAAGGATGCCAGGTCTCAGTTCTATATA
GTAGGTCTAGGATTAAGTGTAGGGATAGGTCTAGACTTCCCTCCGTGGGGTATGGCGTGATGCCGAGTAGAAGCACTGCGTCGGCGCTTACGAGCGGCGC
CGGACGCCGTTCAGATTCGCTTACCGGCTGCTCTCCGTGGTGGAGAGAAGCCGCGGGATGCGGATCTGACTCCAGCTTCTCCAATAAGCTCGATCTCGTC
CCTGATTTCGAGGATGGCCATCGCTTAGTCCTATCTTCTCGTTGCTGTCGTGGTGGTGGGAACGGAAATAGGACGAGGTGCAGAGCAAATTCCCTCGATT
GGGCTGGTGCATATTCTCGTCGGTGCCTGGGGTGGAGCTACGGCGTGCACTGTTGCTGCCGGTCTCTGCCGCCTCTCCGGCGACCTTTCTGGCCGAATAG
CGGCCCCGTGAAGCCATGGTGTCTGCGTTGGCTTCGTTTCTTCCTCCCGGCTTGATGCCTTTAGGGAGGCAGCTATTCAGCTTCGGTATGGAGTCTTCCT
CTTCCGTCTTCTGCCGGAGATGGAGTGGTGGCGGTCCGGTGATCCCAAGTGGTTTTGTCCCCGGTGATGGCAAGACTGGATCTGTGCTAGAGTTGATATT
TGGACTTGATTGTAATCTTGATTCTCTGGATAGGGTCCTCCTTGTAAGTTTCAGGGACTATGATGTAGTTTTATTTTCCTTTGGGTCCTGGTCTGAGCTT
TGTACTACAACTGCTGGGAATTAA
page-top