Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig19763  (registered. 2012)
Contig Information
Length 718 bp
Clones alternative view 53 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_dL Crown of seedling 2
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 5
Wh_oh Pistil at heading date 8
Wh_r Root 2
Wh_yd Spikelet at late flowering 4
Wh_EM Dormant seed with water absorption 4
Wh_OKCS Seed DPA5 3
Wh_SHC Shoot grown with cold treatment 2
Wh_VSCB Liquid cultured tissue 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 3
WH_XN Leaves, plant was grown at constant 23Ž 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XC Root, treated at 50 microM Al for 6h 4
WH_XE Seedling, infected with leaf rust 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|66840992|emb|CAI64395.1|| putative high mobility group protein [Triticum aestivum]
Score 220
Evalue 1.00E-55
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig19763
GCAAGCCAACATAATGACTGTTTCCACATGCTGTGGAAGTCCAAGAAAGAAAAGCAGTCAAGGGTTTTAAGCTTTTCTTCGCTAATAGTCAAACAGAGAC
ATCTCTAGCATGCCACAGCCCAGGAGTACGCATCTAAACATTCTCCTTACATAACATTACATAATGAGGACATCGACATGGCAAGCTAAACCCTAAGCAG
CAAACGCTGATTTGCACCACTGCTGTTCCCTCATCTACTATTTACTCCTCGTCCTCCTCGCCATCATCCTCAACGTCAGAACCTTCTTCGTCAGCGTCAG
TCTTGGCCTTCTTGGAGCTAGTGCTCTCCTTCTTGTTCACCGCCTTGCTTGCTGGGGCATCTGCCTTCTTGCCGCCATACTTTGCCTTCTCCTCATCCGA
CATGCTGCGCCACTTCTCCCCAGCCGCCTTGGTGACGGCCGCGACGCCCTTTGCCTCGGGGTGCTTCTCCATGTACTGTGGCCTGAACTCAGCCAGGAAG
GCGAAGAAGGGGGTGGGGGCGCGCTTCGGCTTGGCGACGCCGCCGGTGGCCGTCTTGTTCTTGCCGGAGGCCTTGAACGCGGTGTCTCCGTTGGCCTTGG
ACCTCATGGCGGCGGAGCGGGCGAGCGGTTAGGGCTTTGGGGAGGGTGAGGGCGAGGGCGTCGGTGCGGAACTGCTGCGGAGTGGGGAGCGGAGGGAATG
GGACGGGGAAGGACAACG
page-top