Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig19757  (registered. 2012)
Contig Information
Length 1009 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
Wh_SHDr Shoot grown with dessication 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222616933|gb|EEE53065.1|| hypothetical protein OsJ_35807 [Oryza sativa Japonica Group]
Score 355
Evalue 2.00E-157
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig19757
GGATCCTGAGGTGCAAGGCATACTAACTGCTGCAAAGAGGCAATGGCCCCACATTCACATATCCGACTCATTGGTAATGGCAGATAGTGCTGTTCAGATG
GCTGAATCAGGATGCAAATATATCGCTGTGCTAGGTGTTGACTTCATGTCAGAAAATGTCCGTGCAATACTTGATCAAGCAGGATTTACTCAGGTTGGTG
TTTATAGAATGTCCAGCGAGCAAATTGGTTGTTCCTTGGCAGATGCTGCTTCAAGTTCTGCTTATACACATTTTCTTAAGACGGCATCAAGATCTCCTCC
TTCTTTACATGTCATTTATATCAATACCTCACTGGAAACAAAAGCTCATACTCATGAACTTGTTCCTACGATAACCTGTACCTCTTCCAATGTTGTTGCA
ACTATACTACAGGCATTTGCCGAAATACCAGATCTTAATGTCTGGTATGGTCCTGATTCCTATATGGGTGCGAACATAGCAGACCTATTTAAGAGAATGA
CTATCATGTCAGATGAAGAGATTACAGAGATACATCCAGATCACAACAGGAAAACTATAAGTTCATTATTACAACGTCTTCATTACTATCAGTCCCAGGA
GAAATGTTCTCTTTGTCAATGGAAGCAAAGACGAGAGGAATGGGAGTAGTTGGATCCACTCAGAATATCTTAGATTTCATTAAATACCATTTGAAGCAAG
CTCTGGATCGGAATGTTGATGATCATCTTCAGTTTGTATTGGGAACAGAATCAGGAATGATCACTTCGATTGTTGCTGCTGTCCGGCAATTATTTGACTC
CTATGAATCTTCCAAAGAAGGTGCTAGCATTGAAGTAGAAATTGTGTTCCCTGTTTCGTCAGACGCAATTTCTAAGACATCTATTGATGATTCCCAAGAT
TCCGGCTCTTCAGTAGCGAATGATTTAGAACAGATTAATATTGTGCCTGGTGTGTTTTCTGGTGAAGGGTGCTCTATCCATGGTGGCTGTGCGTCATGCC
CTTACATGA
page-top