Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig19715  (registered. 2012)
Contig Information
Length 1049 bp
Clones alternative view 91 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 4
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 2
Wh_yd Spikelet at late flowering 1
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 2
Wh_OKCS Seed DPA5 4
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 4
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VABA Shoot with ABA treatment 5
Wh_VHS Shoot with heat shock treatment 1
Wh_VSCB Liquid cultured tissue 7
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23Ž 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 16
WH_XR Roots, 18 day old plants were grown hydroponically 4
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XE Seedling, infected with leaf rust 3
WH_XF Seedling, infected with leaf rust 10
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 2
WH_F/WH_R 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|112385746|gb|ABI17930.1|| glutathione S-transferase 2 [Oryza sativa Japonica Group]
Score 381
Evalue 7.00E-104
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig19715
ACCCACTTGAGTTGCCTTTTTATTTCCGTGTCCCACTTGGCTTCCGGCTCGACCGAGCGCTGCCGTGGTCCACTTCTTCCCTGGCCGCCGGCCACGAATC
CGCGCCTCCGAGACCGAGCTGCTGCTAGCTCCGAATGGCTTCGGCGGAGGCTCCGACGGCAAGGCCGATTCTCTACTCGTACTGGCGCAGCTCCTGCTCC
CACCGCGTCCGCATCGCGCTCAACCTCAAAGGTATCGATTATGAGTACAAGGCGGTGAACCTCCTCAAGGGCGAGCAGTCTGATCCTGAGTTCATGAAGC
TTAATCCTATGAAGTTCGTCCCTGCCTTGGTCGACGGCGACGCAGTAATCGGCGACTCTTACGCAATAGCATTGTATTTGGAGGACAAGTACCCTCAGCG
CCCTCTTTTGCCCCAAGACCTTAAAAAGAAGGCCCTGAATATCCAGATAGCAAGCATTGTGTGTTCTGGTATTCAACCTCTTCACAATCTCACCTTGGTG
AGATTTATCGAGCAAAAAGTTGGAACAGGGGAGAGCATCCCGTGGGTCAAACAACAGATTGATAGAGGTTTCACAGCTGTTGAGAACATGATCAAAGGCT
GTGCTGGGAAGTTTGCTATGGGAGATGAAGTCCAACTGGCAGATGTATTCCTTGCACCCCAGATTTTTGCTGCGGTGACTCGTTATCAAATCGACATGTC
GAACTATCCCACCCTCGCGAGGCTCTACGATCAATATATGACACACCCTGCATTTGAAGCTGCGCTCCCTGACCGGCAGCCGGATGCCCCTTCCTCTGCC
TAGACATAGGCCGGGAGTGAATCAGTAGTTCTCACTGCTTTGTCTGTACCTGTGTGTGTCCTGTCCCGTTACTTCAAACTCTGTAACAATAAGCACAGAA
CTTCCTGCACCAAGTGTAAAGTAACTACTGTAGTCTGTATCAAAACAGTGAAATAATTGTGATCACTAGCCTTTGGATATCTGGAATTCTGGACTTACGT
GAAATAGCAACAAGATGAAACATCAGTGGCTTACATTTCAAAAAAAAAA
page-top