Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1971  (registered. 2012)
Contig Information
Length 1454 bp
Clones alternative view 66 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 2
Wh_r Root 2
Wh_yd Spikelet at late flowering 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_RDr Root of dessiccated seed 4
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 4
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23 3
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 5
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XC Root, treated at 50 microM Al for 6h 4
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XE Seedling, infected with leaf rust 5
WH_XF Seedling, infected with leaf rust 4
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 7
WH_XV Leaves, plant was grown at constant 23 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|40643250|emb|CAC83720.1|| cathepsin B [Hordeum vulgare subsp. vulgare]
Score 701
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1971
AAATTCTGAAAATCTCAAAGGTCCATTAGTATTGCATGACATAGGCGCAATATTTAGTCCCACGTGGGAGCAGAGGGGGTGTTGAGCCCCGCATATGAGG
GGTTGTTTTTCTCACCTCCCTCAAGCATGAGAACTCTGCACGCGTCGTATTTCGTGAATGAACACAGCTCAGCTTCATTTTTGCCAATTGAAATGGATAA
TTGTTTGTCACTCATAGATGCCTTGATAATAATTGTTTTATTACCATTAACGGACACATTAATAGCTAGTGCACAGAATACAGATTCCTGGTACCATCAA
TGCTAATCTGCCCGCTTAAACTTGAAAGGCAAATAGCTAATTCCAACAGCATCAGAGGAGAAGGGGCAGCTCAAACTTTAAATTGCGAAGGCGCTACCGG
CGATGTTCTTTGTCGAGGGCATACCGGCAGTAACATCTTCTTCGATGCCACATTCATTCTTGCCCCTTATGATCTTGAAGTACCCGTCATCGCCCCAGCC
TCTGTTCCACTGATTTGCAAGAAGCCAGTAATCCTCGCCAGCATCACTAGTTCCCCAACCAATCAACTTGACGGCGTGACCTCCCATGACTCCACCGGTG
ATGTGCTTGTACACTCCTGACTTGTAGTGTGCGAAGTCCTCATAAACTGTGAAAGCAACTTCTACAGGGCCATTATTGTAGACCTCTGCCATGATGTCAT
GTGGATCAGAGTTTACTTGGTATGCATTGATGCTGAAATGTTTCTTTTCCTCCCAAACTTGGTTCTGCACCTTGCATTTCTTTTCACACACAGGTGTAGG
ATAAGCAGGTTCACATCCAGGATGCTTGCAGCCAACCTGATCAAAGTATGGATCGCACTCGTCAGTAACAACACCATTCTGGACGAAGTATTGCCACGCA
CTGATAGGATATCCTCCATCACAACCATCGCCACACATAAACCCACAGCAAGCCACTAGGTCATTGGCAGAAAGTGTAATGTTCATGTTGTGATGGATGC
AGAAACGATCTTGCAGGCACTCCACGGCACCAAAAGCCCAGCAGGAACCACAGTGACCTTGATCAAGTATTTTCCCAATTGTGCTGCAACCGGACCATTT
CGACCTGGCGTCGAACACCTTTGGGAGCTGCTCCGATCTTGAATGAGTTTTGGTGCGAACAGCAGCCCGTAAACCTGGAGGCGTTGGCTTCACTCCCAGC
ATATGCTTAAATTGCTCAATAGTGTAATTCGCGAGGTAGGGGTTGTGTCCAGCCGTCCATCCGGCGTTGGGGTGGTTGTTGACCGTTTGTATGATATCTT
TCTGGATGATTCCTAGGGAATGGTCTCTCCTTGCTGCACCGACGAGCTGGGGGGCGGCCGCGGCGGCGGAGAGGACGACGAGCAGCGCCAGCGGGAGTAG
GCTCCCCATCTTCGTCCTCGATCGGCGACGGGGGGAGGGAGGAAGCAGAGGAGG
page-top