Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1970  (registered. 2012)
Contig Information
Length 871 bp
Clones alternative view 33 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 1
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 2
Wh_yd Spikelet at late flowering 3
Wh_CSEC Callus 1
Wh_DPA20 Seed DPA20 1
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_OKCS Seed DPA5 3
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 1
Wh_SHC Shoot grown with cold treatment 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_SP 3
WH_XF Seedling, infected with leaf rust 4
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|212721578|ref|NP_001131442.1|| hypothetical protein LOC100192774 [Zea mays]
Score 335
Evalue 5.00E-90
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1970
AAAAACAGTAAGGACAACACTTCATGCAGAGTAAACTAACTCAGAACCAGGCCTGTAAAATCAATAACAAGATACGTTTGGTTCACAAAAAACGAAGCAG
CATCACTGAGTTCACTTCTTCTGCTCGGTAGTCACTAACCAAGCAAAACCAACAAACATAAGTTTAATTTTAGAATCGATAGCCAAATGATTCTGAAGCA
ACGAAAGCTCTACACCACTAAGTTTCTAAGAACGAACCAAAGTTTGAATCATTTCCCGTTGCAAGATCCACAAGGCAATCTCAACATTTCTGCAACGGAA
GTTATGCGGGTCGAGGCTGAGCGCTTAGTCTTCCTCCTCCTCGCCGTCATCACCACCACCACCTGAGGCCTTCTTCTGGTTCTTCCGCTTCACTCTTCCA
GGTTGGCCACCACCAAGGGGGCTGGTGAGCGAGAAGTCGACGTGTTTCTCAGTGTCCACCCTCACCATGAAAGAAGGAATGTTGACGAGCTGCTTTCCAA
CCCTGATGTGGCGCTGTCTGATAAGGACACGCGCATGATGGATTGACTTGGCCATGCCATTCTTGAAGACGATGGTCTGGAGACGGCGCTGGAGGAAGTT
GTCAACAGTGAGGGCAAGCACGTAATCAAGCTTGTTCTGTTCCTCAGTGAGAAGACCGTAGCGGTTCATGCGGCGGAGGAGAGCCGCACCCTCAAAGATA
CGGCGGGGGTTCTTCTCATCCAGAGTGAGCAGCTCCCTGGCAGCATTTCGGATGCGGCTGAGGGCATACTGCACACGATAGAGCTCACGCTTGGCCCGCA
GACCGTACTCCCCAACCAGCTTCAGCTCAGCGTCAAGACGCTCCTTCTCATACGGACGCCTTGGCTTCTTG
page-top