Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig19690  (registered. 2012)
Contig Information
Length 504 bp
Clones alternative view 49 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 2
Wh_oh Pistil at heading date 5
Wh_r Root 2
Wh_yd Spikelet at late flowering 4
Wh_EM Dormant seed with water absorption 2
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 3
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 7
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 3
WH_SP 2
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 3
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|291410763|ref|XP_002721657.1|| PREDICTED: histone cluster 1, H2ag-like [Oryctolagus cuniculus]"
Score 207
Evalue 3.00E-52
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig19690
TTTTTTTTTTTTCAAGGATAAACTAGTTGAATTTCCATTCAATTCCATTCTACAGAAGATAGCAAACAGCAGCGAGATGCTGCGATTACATCAACGACCA
CGAACCCTAGACACAGGCTAGCTAATCTGGTGGCGGCCTAGCCTCCGAATCCGTAGAGGGTGCGTCCCTGGCGCTTGAGCGCGTAGACGACGTCCATGGC
GGTGACGGTCTTGCGGCGGGCGTGCTCGGTGTAGGTGACGGCGTCACGGATGACGTTCTCGAGGAAGATCTTGAGCACGCCGCGGGTCTCCTCGTAGATG
AGACCCGAGATGCGCTTCACGCCGCCCCGCCGCGCCAGACGACGGATCGCCGGCTTGGTGATGCCCTGGATGTTGTCGCGGAGCACCTTCCGGTGGCGCT
TGGCGCCGCCCTTGCCGAGTCCCTTGCCTCCCTTGCCGCGGCCCGACATCTTCTCCCTTCTCCTTCCTTCTCCTCGGTGAGGTTGACTTGTCTTTGCCTC
GTGC
page-top