Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig19680  (registered. 2012)
Contig Information
Length 654 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 2
Wh_VSCB Liquid cultured tissue 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226504206|ref|NP_001146236.1|| hypothetical protein LOC100279808 [Zea mays]
Score 361
Evalue 3.00E-98
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig19680
TGAAGCGAACCCACGCTGTTCGCCGACCCGTCCACTGCTGCTCCGGCCAGCCATGAGGGTCCTCGCGTTCCTCCTCCTACTATGGATCTCTGCCGCCGCC
ACTGCATCCCCTCCGCCGCTCGAGACCCTCGGCATCCCTCCGCAAGATGAGGCGTACTACAGGGGCGGCGTGATCAAGTGCAGGGACGGATCGGGCAAGT
TCACCAGGGATCAGCTCAACGACGACTTCTGCGACTGTCCCGACGGCACCGACGAGCCAGGGACATCCGCGTGCCCGGAGGCGAAATTCTACTGCAAGAA
TGCCGGACATTCTCCAATCACCATCTTCTCGTCGCGAGTGAATGATGGTATATGCGATTGCTGTGATGGGAGTGACGAATACGGTAGCAATGGCACTTGC
AAGAATACATGCTGGGAAGCTGGCAAGGCGGCGAGGGAGAAGTTAAAGAAGAAAGTAGCTACATATAAAAGTGGTGTCGTTATTCGGAATCAGGAAGTTG
AAAAGGCCAAATTGGCAATTGCTAAAGATGAAGCAGAGTTAACAAAACTGAAGGGTGAAGAGAAGATACTCCAGGGGCTTGTTGACAAGCTCAAAGAGCA
AAAGAGATTAATAGAAAAGGCAGAGGAAGAGGAGCGCCTAATAAAAGAGAAGGA
page-top