Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1968  (registered. 2012)
Contig Information
Length 807 bp
Clones alternative view 82 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 3
Wh_dL Crown of seedling 9
Wh_e Seed DPA10 5
Wh_h Spike at heading date 1
Wh_r Root 2
Wh_yd Spikelet at late flowering 5
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 4
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMV Shoot grown with continuous light after cold treatment 6
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 1
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VSCB Liquid cultured tissue 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 3
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_SP 2
WH_XA Root 5
WH_XC Root, treated at 50 microM Al for 6h 9
WH_XD Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242058553|ref|XP_002458422.1|| hypothetical protein SORBIDRAFT_03g033230 [Sorghum bicolor]
Score 257
Evalue 9.00E-67
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1968
CGCTAGAGTTGCTCCAATGACACCTAAACAGAACTTGAAATCGCTCGTAAGAAATCATTCCATTGCGCAACATGGAAACATTCAAGGGGAAAATAACCCA
CAATGAATTTTGACTGATCAACAGCCGAAACCAAGAACAACGACAACCAGGTGTATAACAAGTTCCTCAAAATCATAGCATAAGATACTACAAAATGCCT
CTTAACATACCAGGAGATGACATAAATGATAAAGTCTTTTCTAGTTATAATTAAGCACTCAGCAACATTGCAACAGGGATACCGTCCTAAACCAAGGACA
GGCCCTTACTTCTTCTTCGCATCTCCGGCCTTGGTCTTCTTCACACCACGGATCTTCTTGGTCCTGTTTTTCCTTTCCTTGATCTGCTTTCGTGACTTCT
CCACCTTTGTAGCAAGACCGTTCCTGATGAGGCGGTACTTGGGCTCGAACTTCTTGGCGGACTCGAGGTTGTCGTAGATGAGACCAAACCCGGAGGACTT
GCCGCCTCCGAAGTGGGTGCGGAACTTGAACACGAAGATGCAGTTGGGGTCCTTGACCTCGTACACCTTGGCGAGCCTCTCCTTGAGCTCCGCCTTGGAG
ACGTTGGCGCGGCCGGGGTGGATGACCTCGAGCACGAACTGCTTGCGGGCGAGCAGGCGGTTGGTCATGAACTTGCGGGTGCGGAGGGTGACCGCCGTGG
TGGTCTTGGCGTCCGCCATGGCTGATTCGACCTCGCTTCGCGGTGGGCTGACTGCGGAGGAGGTGGCGGCGGCGGCGGCGGCGCGAGGGGGAGGAAAGCC
CTCGTGC
page-top