Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1961  (registered. 2012)
Contig Information
Length 805 bp
Clones alternative view 34 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 2
Wh_CSEC Callus 1
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_V4816 Shoot grown under cold condition for 16days 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 5
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XE Seedling, infected with leaf rust 6
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 6
WH_XV Leaves, plant was grown at constant 23 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|212275013|ref|NP_001130228.1|| hypothetical protein LOC100191322 [Zea mays]
Score 328
Evalue 3.00E-88
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1961
TTTTTTTTTTGCAGTCAATATTCTGGTGCATATATGTATGTATAGAGTGGGGACACGAGTTTTCGAAAATGTCAACTGTCAACACATTCCTCTCCGCTTA
TGCTTGCACCCGGCCCCTATCCAGCAAGGCGCTTATTAACAGGCCAACCATACAACAACACGTTCCGAATTCTCCAGCGAACGTCCTTCAGTGTATTGAC
AAGGAACACGATGGATGATCGACACGCGCCCGGACACTCATTTCTTGTCTGGGATCTTCTCCAGGAGCTCCTCCAGGACCTGGAACAGATCGCCAACGAT
CCCGTAATCCGCGACCTGAAAGATTGGGGCGTCCGCGTCTTTGTTGACCGCCACGATGTACTTGGAATCTCTCATCCCTGCCAAGTGTTGTATCGCCCCT
GAAACTCCGAAAGCAATGTAGAGCTCAGGCGCAACAATCTTCCCGGTCTGCCCAACTTGAAGTTCATTCGGCACATATCCTGCATCGACGGCAGCTCTGG
TCGCACCCACTGCCGCGCCAAGTTTCTCTGCCAGCTGCTCCAACAATTTGAAATTCTCGGCGCTCTTCAAACCTCTGCCTCCAGTGATTACCACGCGTGC
ATTTGCAAGATCTGGCCGTTCTGTATCTTGGGATGTAAGATTCACCCATGAAGATTTCCTTGAGCTTGCTTCACTGAGGAAAGAGAGATCAACCTGGGTT
ATAGGTGCAACTTTAGTTTCTGACACAGACTCGGTAGCTGGAGAAAATGATGTTGATCTAATACTCATCATACAAGGAGACTCCCCAGTATATCGTACAG
TGCAG
page-top