Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig19582  (registered. 2012)
Contig Information
Length 576 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242117510|dbj|BAH79993.1|| hypothetical protein [Oryza sativa Indica Group]
Score 359
Evalue 8.00E-98
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig19582
TCTACATCATCTCCATATATTGCTCTTATGGATTCAATTGCATCCTTGTCACTTGTNNNATCCTCCCAACTTTTTATTGGAATCAGAAATAGTCTCCTCC
TGAACTCATTGTACATCGGTACACTTCTCTCCCTGTCTCGGTATACTTCTAGGGCAGCAAGGTCGATTCTGTCAGATTGATTGGTACCATCCAAATTTTG
TGGTATAAGGTCCCTGAAGAAACTTGGGTAGTTCCATAGTTCAAGTGCACCACAAGCTTGATATCCCATTGATAATGTTTGTTTTTCAAACCCTATTTTT
GATAGCTGGTATTCCCCCTTGAGACCAACCAACTCTCCAATATCGATGTCTTCCAGGTACGGTGGGGAATTATTTGCAGCGGGTTGCCCGGTCGGATCCC
TGAGCTTGAGAGTGCTTGGTATTAAGGAATGCATTCTGTAAGCACTGGTAAACTCTTCAGTCAATGAATAAGGTACGCCATGGTTGATCGGCTCCTTCAA
TCCCACAAGCCCACCTAATGCCGTTCCTCCTGTGTGACCAAATGTATCTTTTATTTTCTTACCCAATAATCCATAC
page-top