Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig19506  (registered. 2012)
Contig Information
Length 540 bp
Clones alternative view 29 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 6
Wh_EMI Dormant seed with water absorption after breaking 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 3
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 4
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XE Seedling, infected with leaf rust 2
WH_XF Seedling, infected with leaf rust 4
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig19506
TTTTTTTTTTGACAGGCTTCATGTCATGATTCTAATAAGTAATAGCTTGAACATGACCCGAATAGACTCAGCGTCGGACAGTCTCCGGACATGGCACACA
CAGCAAGGCACACACGTTGCTCCGTGTTGTTTATTCACATATGATTGTAGCAACATCTTATATTATAAGACGGATGGAGTAACATAACCGTGCATTTTGG
TATCTTTATTTATATCGGCATCGAACGCTCACTGCTCAGTAACAAATAACTAAATTACTCTTGACCGGCATACTTGTATTCCCGTCCTTGGCATAGATCG
CCACCAGCCTACTTTGGAGGATAGCGCGGGAGCGGCCCCGGCCGCACCTGGTAGGAAGGGGACGCCCAGGTTCCCCTCACACCATCTCGCTTCACGTTGC
TTAAATCACCTCTGGCGGCGAGCACGGCCTGTGCGACGAACATGAGGGAGGCCAGCATCACGCACAAGAACGCAACCAGGCTTCTGAGGTGAGCCATGGT
TGAAGAAAGGAAGCAAGGAAGGATGCGTGTGTTACCCCGG
page-top