Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig19500  (registered. 2012)
Contig Information
Length 1334 bp
Clones alternative view 16 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 1
Wh_yd Spikelet at late flowering 1
Wh_DPA20 Seed DPA20 1
Wh_VSCB Liquid cultured tissue 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 3
WH_XT Roots, 18 day old plants were grown hydroponically 5
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226498742|ref|NP_001146299.1|| hypothetical protein LOC100279874 [Zea mays]
Score 416
Evalue 4.00E-114
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig19500
TTTTTTTTTTGAGTTTATTAATATCTATATTGATACCAATGCAACAGACAAGACACTGTAATACCATCAATCATCCAGGGTATTTCAAAGGTCCAGACTG
ATCAATTCAAGGGTACGGAAAATGGACCAGCTAGTATGACAGACTAAGTAACCTCTTACAACTTATAATTTCCAAAACCAACAACACCCCCAAAGGACTC
GCATCCTCTTGTAAAGGAACATGGAAAAACTATTGAGTCGTCAAAACGTAATGTCACCCGAATGACAGACCACTTTCAGCAACAAGAAGCTTCGGCAGAG
TTGACAGACGAAGCAGGATAACATCTCTGTGCACGGCAACCCTCCGAATTGCTAACACTAACAATTTTGACAATCAGAAAAAGGTGTATACAGAACTAGC
TGCGGCACTAGGCCACGCAGATTTACACTCTGAAGCTTTGCCTTGTCTTGATCATACGCTTCAATGATGAGAGCCAAAAGTTGCACTCATCCCAATCACT
GGTCGTCAGAAGAATCTGAAGTTGCATTGCAGTGGCAAAATCACTACTATCAAGTGCACTGCACATCTGAATGAGTTTTGATGAAACATTTGGAGATATA
TCTCCAGTGTTGAGTTTGGCAAATAATGCCCCAATCTTCTTTGAGTTGTCTTCAATTTCACGTTTTTTAGCTGGTGCACCTCCCAAGGCTTTGGAAGTCT
CATCAAATAGTCTGGTCAGTGTTGCAATAACAGGTCTCAGCTCAGCAGACACATTCGATGTATCAGCTGTTTGCACAGTGGGGGGAGGTGCAGGAGGAGC
AACGGTAGGCTGAGCTGGTGGTTGCGCCTGTGTTGGACTTGAGGGCTGTGCAGGACTCAAGCCTGGCCGCTGAACAAAACCTTGATTGGTTGACGGTATA
AACCTAGAAGCTGAATTAGTCGGAACAGCAGGGGTAAACATCTGGTTAGGGTTTGTTCCTGGAACTGAAGGGACGGGTGGAACAGTCTGGTATTGAGCCG
GCGGTGCAGGCTGATGAAACGTGGTGGGAGGTCCACTTTGGAACTGGGCAGGTGGTCCAGGAGCATATGATGAATTCGCAGGAGGCGTGTAGAGCTGGGA
ACCCAAGGTACTTGCTTGGTGATATTGCTCTGGGTTTTTGAGACTCGGTACGTTTGCAGGAGTAAATGTCTTCACTGTTTGATGTGGAACCGGGAATGGA
GCCGGGCTTGGCTGGGTGTCCACTGGTGTGTTTTGAGGAACAAACATTTGTGTTTGATGTTGAGGTTGATATCCAGCATATCCCGAGTAGGCTGCATTGT
GTGATTGCGGGTAAACTTCTGGATATGTATTGCT
page-top