Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1943  (registered. 2012)
Contig Information
Length 1397 bp
Clones alternative view 44 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_r Root 1
Wh_DPA20 Seed DPA20 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_SHC Shoot grown with cold treatment 3
Wh_V4816 Shoot grown under cold condition for 16days 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 3
WH_XT Roots, 18 day old plants were grown hydroponically 4
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_SP 3
WH_XB Root 4
WH_XC Root, treated at 50 microM Al for 6h 4
WH_XE Seedling, infected with leaf rust 3
WH_XF Seedling, infected with leaf rust 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 5
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|122220777|sp|Q4LB22.1|METK3_HORVU|METK3_HORVU RecName: Full=S-adenosylmethionine synthase 3; Short=AdoMet
Score 740
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1943
CTCCGACGCCGTCTTGGATGCCTGCTTGGCCCAGGATGCCGACAGCAAGGTCGCCTGCGAGACCGTCACCAAGACCAACATGGTCANNNNNNNNGGCGAG
ATCACCACCAAGGCCACCGTCGACTATGAGAAGATCGTGCGCGACACCTGCCGCAACATCGGTTTCATCTCTGATGACGTTGGTCTCGACGCCGACCGTT
GCAAGGTGCTCGTCAACATCGAGCAGCAGTCCCCTGACATTGCCCAGGGTGTTCATGGACACTTCACCAAGCGTCCCGAAGAAGTCGGCGCCGGTGACCA
GGGCATCATGTTCGGCTATGCCACCGATGAGACCCCTGAGCTGATGCCCCTCAGCCACGTGCTTGCCACCAAGCTTGGAGCTCGCCTCACGGAGGTCCGC
AAGAATGGCACCTGCGCCTGGGTCAGGCCTGACGGAAAGACCCAGGTCACAGTCGAGTACCTAAACGAGGATGGTGCCATGGTACCTGTTCGTGTGCACA
CCGTCCTCATCTCCACCCAGCACGACGAGACCGTCACCAACGACGAGATTGCCGCGGACCTCAAGGAGCATGTCATCAAGCCGGTGATCCCCGCGAAGTA
CCTCGATGAGAACACCATTTTCCACCTGAACCCGTCTGGCCGCTTTGTCATCGGCGGCCCTCATGGTGACGCCGGTCTCACCGGCCGCAAGATCATCATC
GACACCTATGGTGGCTGGGGAGCCCACGGTGGCGGTGCCTTCTCTGGCAAGGACCCAACCAAGGTCGACCGCAGTGGCGCCTACATTGCCAGGCAGGCTG
CCAAGAGCATCATCGCCAGCGGCCTCGCACGCCGCTGCATCGTGCAGATCTCATACGCCATTGGTGTGCCTGAGCCTTTGTCTGTGTTCGTCGACTCCTA
CGGCACCGGCAAGATCCCCGACAGGGAGATCCTCAAGCTCGTGAAGGAGAACTTTGACTTCAGGCCCGGGATGATCAGCATCAACCTGGACTTGAAGAAA
GGTGGAAACAGGTTCATCAAGACTGCTGCTTATGGTCACTTTGGCCGCGATGATGCTGACTTCACCTGGGAGGTGGTGAAGCCCCTCAAGTTCGACAAGG
CATCTGCCTAAGAGCATGGCATTCTCTTGGTCTGCCGCCTCTCAAGTTCGTCAAGACGGGATCATGTTGCTCCTGGGAAGTGAGAAGAAGCATTAGACAT
TGAAGCGACGCTCTACACTGGTCTTGTTGTATGGTAGTCAGTGCTAAGTTTCTTACTGTCATTTCATATATTTATCCTTTCCATTTTGAGTCGCTGAAAC
TGCTGAGTGATGTGCAGTTTGCTCTGTTAGTCGCTCTGTCACTTTCACTTTTCATATTCTTTGTTGTGTAGTTCCCTCATAATGCTCTTTCTTCCTG
page-top