Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig19383  (registered. 2012)
Contig Information
Length 1093 bp
Clones alternative view 114 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 2
Wh_SHDr Shoot grown with dessication 6
Wh_V4816 Shoot grown under cold condition for 16days 26
Wh_V483 Shoot grown under cold condition for 3days 18
Wh_VABA Shoot with ABA treatment 2
Wh_VHS Shoot with heat shock treatment 6
Wh_VWD Shoot grown with dessication 3
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 4
WH_XN Leaves, plant was grown at constant 23℃ 17
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 4
WH_XE Seedling, infected with leaf rust 8
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 13
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|7716956|gb|AAF68628.1|AF255053_1|AF255053_1 cold-responsive LEA/RAB-related COR protein [Triticum aestivum]
Score 324
Evalue 1.00E-86
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig19383
CATGCATCAAGGCTGCCCTCCATTGTCCGGGTGAGGGGGAGGTGCACCGACACCGCGTGGCGGCGGTGGGCATCGAAATAGTCCGCGGCCACATGGAATC
GGAATGTGGGGACGGGGAATGATACCACGCGGTGTGCTTGGGATTGACCCGGGTCGACCGCTGATCTCCCTGTGAACTCCGTGGCAGCCCGTGATAGCAG
CGGAGAAGACGACCAGCAACGCGACCACCAGGAGACGGGCAGCCCTGGCCAGCGACGCCATCTTGTGGTCAGTTGTGACTACTTAGCCATCTCGAGGCTT
AATTTGAGCTGTGTGCACCACAAATTAGTACGTACCAACACTCCATCAACTTCAAAAATGTCTGGTTGGTTTCAAGAGAAGTCCGGCGACGCCACCAAGA
CGGCGTCCGAGACGGGGCAGACCATTCAAGACCGCGCCGTCGAGGCAAAAGACCAGACCGGGGCCTTCCTTGGTGAGAAAAGCGAGGCTGTCACGAAGGC
TGCCTCCGAGACTACCGAGGCGGCTAAAAAGATGGGCGGCGAGGCCATGGGGAAGGCGTCCGAGACGGTGGAAGCCGGTAAGGATCACGCCGTCGAGGGC
AAAGACCAGACAGGCAGCTTTTTCGGCGACAAGACTGACGCTGTCAAGAAGACGGCCACCGAGACTGCCGATGCCACCAAGGAGAAGTCCACCGAGGCCG
CCCAGCATGTCCAGGACACCGCTGCACAGTACACCAAGGATACCCCGGTCGCCCCCAAGGAAAACGTCTTCCAGCAGGCCGGCGGGAATATGGTGGGTGC
CGCTACAGACGCCAAGGACGCTGTCATGAACACGCTCGGGATGGGAGGAGACAAGTGAGATGCGGGTGGTGCCACCAAGAAGACCACAAAGGATAATAGG
CGCGTCTGCGCTTGCTTGCCCTAGCCCTCCTTCTGTTTCGCTATTCCTTCAATATAATTTAATTTCCAGTTCCATGGCACTAATTTACACATGCTCCTTG
GTGTAACTTTGTATGATGTATCCGACCGAGGTATGAATATATTTTCCACCAATCATAAAAAAAAAAAAAAATTTGGATGTTGCAAAAAAAAAA
page-top