Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig19363  (registered. 2012)
Contig Information
Length 738 bp
Clones alternative view 15 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_SHDr Shoot grown with dessication 4
Wh_VWD Shoot grown with dessication 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 1
WH_XE Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|283806367|dbj|BAI66425.1|| 2-oxoisovalerate dehydrogenase [Triticum aestivum]
Score 357
Evalue 9.00E-97
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig19363
AAATATCAGCAACAACTATTCTTGTGTGAGTAACAGCCAATCTCTTCTATTATTTCTTTCAGAGGTTTTTGATGGGCAGTTTATTCCCCCTTCTTAAATT
ACATACTATTCAAGCTTAATCAATATTAACTCTTACAGTACCAGCTAAATCATCATTCATGAGTACTTGCAGACTCAACATTGCAGAGCTAAGGCTAATA
ATAGGACTAAGCAGGCACATCAGCTGGATACTCTGCAGGATGCTTTTTGATGGTATCCAGCAGCGACCGCTCTTGCTCGCGAAGGTTGGAAGGCATTTGA
TCATACACATCAGTGAAGAGCTCCGCAAGCCCGTGTTTTGGCATCCTCTCGGCCACCTGAATGGCTTGCAGGAGCTCTTGCCGCACATTGTTCCTGAGTT
CAGACTCTTGAGTGTCGCACCACCATCCATTCCCCTGAACCCATTTTCTGTACCTGGAGACGGGATCCCTCGCTGTTCGCCAATGCTCCATCTCATCGGC
CGGCCTGTACTTGGTTGAATCGTCGGATGTCGAGTGATGGCCGACTCGGTAGGTCATCGCCTCGATTAAAATAGGCCTTCCTTCAGTTATAGCCATTTCC
CGGGCGGTGTGGACTGCACTGTACACAGCAAGAGTATCGTTGCCGTCTACCCTGATACTGCGTATTCCGTAGGCCTGACCGCGGGTGACAACTCCATCAC
TTCTGAACTGTTCCGCGGTTGGGGTGCTGATTGCCCAG
page-top