Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig19349  (registered. 2012)
Contig Information
Length 674 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222624299|gb|EEE58431.1|| hypothetical protein OsJ_09636 [Oryza sativa Japonica Group]
Score 145
Evalue 3.00E-37
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig19349
AGGCGATGTTTGATGCAGCGATTAAGGTGGTTCCAGCCATTGAAGCAGAAGCAGAAGAAGTGGAAGGCGCAGAAAGTATGCACGGACAGACCAATGGTGG
AGGCTCGAGGGACGGAGTGCCGCCGCCGCCGCCATCCTCACCCCTGAGCCCAAACTTCCAATTTGATAGATGGGAGGGTCTGCAGAAGAAGAGCCTGGAA
GAGAGCATTCAAGCAAGGTTCCCCCAACGTGAATTCTCTTGTAGGATTGGGTCTGCAGCTGCATTGCTATTAGTGCAGTTTCCTTGCTGAACCCTGAATT
GGCATGGAATTCAACCTTCTTCAAAGAACCGGTCATGCTTCCTGAATTTGTAATTCTGGGCGGATCTCCCGAGGAAAGTGCTCGGCTTAAGGCATCTAGC
AATATGAATGAGCTCATTTCACTCTTATCTCCTCAGTCGAGGCTAGTCGTTACATCATCCGGCGATGATCTTCCTTCAGATGGCACTTTGAATTCGGATG
CAATAACAGTTCAAGTTCTTGTCAATGATGTCCATGTTGGAGACTCAGTATTGGTTATTGAGTCATTAGAAAGGATAGTTGATGATTCTGACTTTGAACA
TGGTACCCATCATCATATTGAAGTATGTTGGTGGTTGGTACCAATCATTTTTTGTGATAGAAGCTTGGCATGCG
page-top