Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig19339  (registered. 2012)
Contig Information
Length 1162 bp
Clones alternative view 37 Clones [Download: TSV  ,  FASTA ]
Wh_VHS Shoot with heat shock treatment 1
WH_XN Leaves, plant was grown at constant 23 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 10
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XT Roots, 18 day old plants were grown hydroponically 4
WH_XF Seedling, infected with leaf rust 4
WH_XV Leaves, plant was grown at constant 23 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 4
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242067961|ref|XP_002449257.1|| hypothetical protein SORBIDRAFT_05g006880 [Sorghum bicolor]
Score 452
Evalue 5.00E-125
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig19339
GATGGATCAACGATGCTTCACTTTATCCCTGAACCATCCGCCTTATTCTTACGGTCATCACACCACTCTCATACTGTCATACAGTAGTAGTTTTGCAAAC
AAGTATGATTGCACGCGCGCACTTGCAAGTGCACTTATTCTAGTACGGCTCTTGGCAAGCCTAATAGTAACTCTTAGTATTGATAGTAGTACTGTAGTGT
ATACCGCGCGTCCGTTTGGAGATCAATTCAATGGTTGGCGACGATCTCCTGCGCCCTGGTCTCATAGGTAAACTTGTAGGTGCTCTGCTTGGAGCTGTCG
GCCGACCAGATGAAGAAGCCCGGCAGCTTGTTCTGCCTTAGCAGCTCCTTGGCGGCGGCGATGCCCTGGTCCGGCGAGAGCAGGCCGAGCTCCTCCGTGG
TCTTGCCGGTCTGCAGGCTGGCGAGCACCCTGGCGCCGGGGTAGAAGCCCGTCTGGCGGTCGTAGAACATGACGTAGGTCGGGACGTCGGTGTTGGCGCC
GTAGCCGTAGAACTGGAAGTTGACGTAGTCGATGACGCCGGAGTACCTGCTCCACAGCGCCCGGTAGTACCTCTGCACGGTGTCGTCCTCGAAGGGCGCG
ATGGAGGTGGTGATGTTGGGGAAGGCGGCCTTGAGCCGGGTGAGCAGCCGGCCGACGCACTCCACGAAGGTGTCGACGGAGACGCCGGCGGCGAAGCGCT
CGTAGTCGACGTCCACCCCGTCGAGGCCGTACTCGTTGATGAGGCGCGAGAGCGAGGCCACGGCGTTGGCCACCCACGAGTCGACGGAGGCCGGCGCGAA
GGAGACCTTGACGATGTCCAGCACGCTGTCGCCGCCGAGGCCGGCCATGACGCTCACGTTCGGGTGCGCGGTCTTGATGGCGGCCACGTCGGCGCGGGAG
AGGTTGGCCGTGTCCCAGAACGCGCTGAACACGCCGTTGGTGGGCGCCGGCGTGGGCTGCTGCGCCACCGGCGTGTAGTCGATGGCGAAGGCGAGGATGT
AGTGGAAGCTGACGCCGGGGTTGACAGGCACGTCGGAGAACCGGACGCCCGTGGACTGCGCGCCGAGGTACTCCCGGAAGAGGTACCCGTTCGTCATGGC
CGGCGGTAATCGAGCTGGAGGAGGCTGGAGCTGGCCTCGGTGTCAGGATCTCCCTAAATACG
page-top