Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig19328  (registered. 2012)
Contig Information
Length 890 bp
Clones alternative view 76 Clones [Download: TSV  ,  FASTA ]
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 13
WH_XF Seedling, infected with leaf rust 5
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 6
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XV Leaves, plant was grown at constant 23Ž 16
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 4
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 18
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226502214|ref|NP_001152394.1|| 36.4 kDa proline-rich protein [Zea mays]
Score 240
Evalue 2.00E-61
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig19328
AAGCTCCATACACATTACAATCACTTTATATTATTCATAATAACTGTCAAAAAGAATGCTACACACCCAACATCACAACTCACACAGTCACATGTATATA
AGCAATTATGCACGATTACAGTATATACTGCTAGTACTTGATAGTTGATACACATTTACACAACGCATGTTCGCTGCTCCACACCAAAAGATAGCCAGAG
CTAGCTGCCCATGCATGTATGCGTTATACAGATTACACATGACATGTGGCATGCATGTACTATGCGTACTTACCTTGAGAAGGTGCTAGCTCCATGCACG
CGGGCATGCATGAGGATGCAGGTGGTGGTACAGTATGTATGTAGTAGGTGCTAATCGATCGATGGAGTGGATTATGAAGGGCACTGGAACGAGGACGGCA
CGTGCTTGCCGCACTGGTTGACGAGCACCGAGATGGCGACGGGGAGCACGAGTTTGACGTTCAGCACCTTGGCCTTGATGGTGGTGCAGAGGCAGAGCGC
GGCGTCGAGGTCGGCCACGCCGGACAGCAGCGGGCAGCAGGTCTCGCTGGCCTTGGCGCCCACCACCGCGTGCACCAGCCCGTTGAGCGCGTCCACGCAC
GCCACCAGCTTCAGCACGTCCACGGGGCACTTGCCCGTCGGCGACGACGGCGCCGGAGGGGTCGGCGTCGCCGGCGTCGGGGGCGTCGGCGCGGGGGAGT
ACGGCGGCGGGGGGCACGGCACGGACGACGGCGGGGGCGGGGGCTTCACCTTCGGCGGCGGCGGCGGGGGAGGCGTCGTCGGGGTCGGGCAGCTGGGGCA
CGCCGACGAGGGCGCGACCAGCACGGAGAGCAGCGCCGCCAGCACGAGAGGCGCAATGCGGGCCATGGAGCCTGGCTAGCTAACCTCGAG
page-top