Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig19314  (registered. 2012)
Contig Information
Length 409 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_r Root 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XV Leaves, plant was grown at constant 23℃ 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig19314
TTTTTTTTTTCTAGATGAACATCAGCCATTTATAGTAGTGTTTCCAGAGTACACATAATAAAGGAAGAGAAAAACAAAACATGGACTTGAAGCATCCATT
GATTCATCACACACAGAGACTTCCGATTATTCGACTTCCACCTGATACAACTGAATGGAGAGAAAAGGATAAAAGGGGGGTGGACTCCTGCCGGAGTTCA
CCATTGCCGTTTTGTGACTTGCCGATTCTTGCGTACCTCAGGCGACCACCTGGGAGGTCAGGAGAGGCACCGCAAAGCTGAAGCGCTCAGCTTTGCGGTT
CATCCCGACCCTGCTTCCGCTCTCAAGAGCCATGTAGATGCTCGAGCCATGCGCCTTCCATAGTCGGTAGGGGCTGTGGACAAGAGGAGAGGGAAGGGTT
GCCTCGTGC
page-top