Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig19312  (registered. 2012)
Contig Information
Length 873 bp
Clones alternative view 74 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 3
Wh_dL Crown of seedling 11
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 2
Wh_oh Pistil at heading date 5
Wh_r Root 4
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 3
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 6
Wh_SHC Shoot grown with cold treatment 1
Wh_VSCB Liquid cultured tissue 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 4
WH_XA Root 14
WH_XB Root 5
WH_XC Root, treated at 50 microM Al for 6h 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|52548254|gb|AAU82114.1|| cytoplasmatic ribosomal protein S13 [Triticum aestivum]
Score 298
Evalue 7.00E-79
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig19312
TTTTTTTTTTGCAATAACCATATAGTCAAACTGTCCGAGCTTGAGTGCACTGAAAGCAGCGATTACACTCGCTCAGATCAGACAACACGAATATCACAAT
GTCTAATTTTAACTGATGAATTGTAGATAGACGCTAAACAGAACCAGACAGAATTGCAAAACCAAAAATGGTTTATGGGATTCTCCAAGTAAACATAGAA
AATTTGGTCTCTTGTTCATCTAAATCGCTCCAAACTCAAAAGCGTTACATGAAATTGATAATATGTAGAACAAGACCATCCTGAAGCCGGTAAGAGCACA
CCAGATGAAGAGCCCTCCTAAGCCACCAGAGTGCTGGCAGTGGTAGACTCGTACTTCCAGGTGGGCGGGAGCTTCTTGGTGCGCTTGTAGTAACGGGCAA
GACGGTGGATCCTGCTCTCAACAAGAATGAGCCTGAATTTGGAGTCCTTGTCCTTCCTGTTCCTCTCAAGATGCTTCCTAATGGCCACAGCCTTCTTAAT
CAAAAAGTACAGATCCTCTGGGATTTCCGGCGCCAGGCCATGAGCCTTGAGGATGCGGAGGATCTTGCTTCCGGTAACGCTCTTGACGAGGGGGATACCG
TGCTGGTCACGGAGCAGAACACCGATCTGCGAGGGCATCTGACCCTTCTTCGCAGCCTTCGTGATCAACTCGTCGACATCAGCGACGGCGGTCTTGACCC
AGCTCGGGGGAGTCCTCTTGTACGGCAGCGCCGACGACGAGATACCCTTCCCGCGGCTGTGCATACGCCCCATGGCGTCAGGCGAGGGGTTTAGCTCCGG
CGACGGCGGCGGCGGTTGCCTGCAGCAGCAGCGGCGCGAAGGGCGAGAGGGGCTCGAGCCTCGTGCCGAATTC
page-top