Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig19300  (registered. 2012)
Contig Information
Length 992 bp
Clones alternative view 29 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_CSEC Callus 13
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 3
WH_XN Leaves, plant was grown at constant 23℃ 6
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 4
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig19300
CTGACAGAGCATGCATCCTCCGCTTGAGAGCTCCACAGGGCACCCCGGCCCGATCCCATGCCTCGTCTGACGGCGCTACCGGTCAGCGATGGCTAGGGGG
AGGAGCGCGGGTTCCTGTACATAGTAGTTATAGCCTAGTAGTATTTCGACTTGCGTTGTTGTGGACTGGCGTTATGCCGTTTTGGAGCTTTACCCCGGCG
ACCTCGGGCGACGCCGGTTGGAGACCCTCTTCCTCCCCTTGTTCTCCTCCATGGTGGAGGCTAGCAGGAGCTCGAGCTCCCTTTCAATAAGCTCGTGGGA
AAGCCAGATCTGGCTCGAACAGGTGTTGTTTGTTCTTCTTCTTTGTGCTGCCATGGAGGTAGGGACGGGGAGGAACTCAGTTCTTTGTGAAGCTGCTGAT
CTGGTGATCCAGGGGATTATCAAGCTGGCTTTCAGTGCAGTCAACGTTAATCTTCTTGCTCTGCTCCGACCCCTGCTTCTGGAGTTGCAGATCAAATCAT
TACGCTATATCCTCTCTGAGAGTTCTTGGAGCCAAAATTTTGCAGCATATGGTTGGGGAGCTCGGTGCAGAGAGCACCATGAGATTCTCGCCACTGTGCC
GCTGCATCTTCTGGTCGAAGGGCGACCACTCGGAGTTCCGGCGACGACGTCCGGCTCTTGTAATTCCTCCTGGCCGCCGAGCCATATGGGAGGCAGTTTA
TCTAGTTCTTCGGCTTGGTATTCACACGTTCTACCTCCGGTTCACCGGTGGTGCTATAACCATTCCTCCACCCCAAGTGGTTTCGTCCCCGGCGGTGGTG
GAATCGTGCCAGGATCGAAGACGGCGAAGAGGACTCGATTGCTTTTCATTTTTGTTGTCTGGGGTCCAATCTGCAAAATATCCGGCCTGGGTTGTAATTT
TATCTTTCTGTTGGGTCTTTATGTAATATGTTGCATGCTTATCTAATATAAGTCTGGGTCCTTCGGGACCCTTCTTGTGTTCAAAAAAAAAA
page-top