Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1922  (registered. 2012)
Contig Information
Length 767 bp
Clones alternative view 16 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 2
Wh_r Root 1
Wh_DPA20 Seed DPA20 2
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_RDr Root of dessiccated seed 3
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_CA 2
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|66271073|gb|AAY43813.1|| beta1 proteasome-7D [Aegilops tauschii]
Score 399
Evalue 2.00E-109
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1922
TTTTTTTTTTCGAACAAGGAATGTACAGTGCTATTAATTCGTAATAACAAGGGAGGAAAATAAGCTGGTGTGGAACAATTCGGCACAATTTCTTAACAAC
ATTAAGCTCAAATTCAGAACAAGTCATCATCAGACACAGTAGGAAGAACCAGTAGGAAGCACGGCTCACTGGACCATGGCATCAGAGCTCCCGGCCGCGA
GAATGTCGAGGAGCGAGTTCTGGGGCTCCATCTCCTCATGCCACAGTGGCAGCTTGTCGCCAGGATGGAAGCTCCTCTTCACGCCCTCCTCATTTATAGT
AACGGTGCGAACAACCCCTCCACTAGCACCATCACGTGCAATGGCAAGGGAAACCACCTTCACCACAAATTTCTCAGCTTCTTCCTGGGTCATCCCCTCT
TTCCATTCATGATCCATCAATCCATACAGATAGCTGGAACCAGATCCTCCAATTGCGAATGGTTGCCTCAGAATCGTTCCACCAAGAGGGACCGAGTAAA
TTTGGCCTCCTTCGTACTTATCCCATCCACCAACTATCATACCAGCTTGCAACATGCTCTTGTTCTGATAGGCCAGCAACCTAACCAAGTTGGATGCGAC
TTTCACGGTAGCTGGTTGCCCAAGCTGAATTGTGTGCTGGTGGAGAAAATAGCGCACATAATCTGAAATAACTTGTGTATCAGCGGCAGATCCAGAACGG
CAGACATAGACATTATCAGTGAGCTGACTAATCTTGTCCGAAGCACGGTTTGCCACATACATTCCAG
page-top