Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig19187  (registered. 2012)
Contig Information
Length 693 bp
Clones alternative view 6 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_DPA20 Seed DPA20 1
Wh_RDr Root of dessiccated seed 1
Wh_SHC Shoot grown with cold treatment 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig19187
TTGCGACGGCACCAACGCTGAGTAGGATGCCCTTCTGACATGACTTCTAGCACTAATCTATAGTCAACACAAGTTCACCCATTGGCTAGGAAGAAGAAAA
GACTTCCAAGAAAAAGAAAAAGAAAATCTTTTCAGGTTCACAGAACAGACCAAGCCCAGAAGTACAAAGGATGTTACAACGACGACAGGCAATCAGAAGA
TCACTAAAACAAGTCTAATGCATCGAATCGGTCTTGAGGGTTCCTTCTTGGACAATCATGCTCTTGTCAAAAACCACCTTCGACCATATTGCAAACTAAA
ACTCTGATCAAACAACTATCATGCATGATTTGCATTGCCTTTTAGCTCAAGCTCTAGCTCATTGTGTCTTAGCTGAAGTTCCAAACGCTTATGCTGAAGC
ATCATTTGTTCATTCTCCAATGTCATCCTTTCAATTTCCCTGTCCTTCTTCATCCTAAATCTCTCCCACTTGAGACGTTGTTTTGCCACTTCCAGTTTTT
GTTCTTGGGCCTGCAAGCGATGTTTCTGAAGCTCTACTTGTTGTGAAGTCAAGCTCGAACGACCTTCAACAAAAGGGTACCTGTACCCGAAACCGACACA
GGTGGGTAGGTAGAGAATACCTAGGGGGCACCCCTTCTCCCGAAGTTACGGGGCTATTTTGCCGAGTTCCTTAGAGAGAGTTGTCTCGCCCGG
page-top