Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig19186  (registered. 2012)
Contig Information
Length 1079 bp
Clones alternative view 55 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 6
WH_XN Leaves, plant was grown at constant 23Ž 4
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 4
WH_SP 2
WH_XF Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 12
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 6
WH_XV Leaves, plant was grown at constant 23Ž 4
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|139439217|ref|ZP_01772659.1|| Hypothetical protein COLAER_01671 [Collinsella aerofaciens ATCC
Score 151
Evalue 2.00E-39
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig19186
GTGGTGCATGGCTGTCGTCAGCTCGTGCCGTAAGGTGTTGGGTTAAGTCTCGCAACGAGCGCAACCCTCGTGTTTAGTTGCCACTATGAGTTTGGAACCC
TGAACAGACCGCCGGTGTTAAGCCGGAGGAAGGAGAGGATGAGGCCAAGTCATCATGCCCCTTATGCCCTGGGCGACACACGTGCTACAATGGGCGGGAC
AAAGGGTCGCGATCTCGCGAGGGTGAGCTAACTCCAAAAACCCGTCCTCAGTTCGGATTGCAGGCTGCAACTCGCCTGCATGAAGCAGGAATCGCTAGTA
ATCGCCGGTCAGCCATACGGCGGTGAATCCGTTCCCGGGCCTTGTACACACCGCCCGTCACACTATAGGAGCTGGCCATGTTTGAAGTCATTCCACCTCC
ACCACCGCGGTACGTACCGTTTGCGATCAAAAGAAAGTCGAGCCATATGGCGAAGGCCGCAGCGATGCTCGTGCTGGTGGCGCTAGTGGTGGCGGCGATG
GCAACGGGCGGAGCGGCGCAGTGCAACGCGGGGAGCCTGGCGGTGTGCGCCTCCCCGATCATCAGCGGGGCCAAGCCGTCGACGACGTGCTGCAACAACC
TAAAGAGTCAGCGGGGGTGCTTCTGCCAGTACGCGCGCAACCCCGCGTACTCCAGCTACATCAACAGCCCCAACGCCCGCAAGACCCTCACCAGCTGCGG
CGTCGCCGTACCGAAGTGCTAGTAGCCGGGCCTCCACCGCCGCCGGCGTGCTAGGCAGCGCCACGCTGCCTATTGCTACTAGTACTACGTAATGTACTAC
TACTACGTACGAGCTCCTACCATGGCTGCTGGTACGACGTCGGTCGAACAGCTCCGTCCGAACCGTGTGTTCATGTATCTTTTTTTCTCTCCAATACAAT
CGTGTGTTCATGTATCGTATGCAAGAATAAAATGGTGTGTACGTGTTGATCCAGCCTCTGCGTAGTTTGTTACTCATTTCTCAATTCTGATCGATAGATG
TCGATCGATCTCGTGTAATTTCTGTACCTCCGACAATATATATCCGCATCTTAACAAAAAAAAGCTACTAAAAAAAAAA
page-top