Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig19133  (registered. 2012)
Contig Information
Length 1568 bp
Clones alternative view 85 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 4
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 9
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 4
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23Ž 5
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 14
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 19
WH_XF Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 6
WH_XV Leaves, plant was grown at constant 23Ž 3
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 15
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|7960277|gb|AAF71272.1|AF251264_1|AF251264_1 ribulose bisphosphate carboxylase activase B [Triticum aestivum]
Score 857
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig19133
TTTTTTTTTTAAGTGGAAAAGGATGATTCAGGTATAAATAGGCAATAACATATACAATTCGATTCTCTTTCAACAAGAGACTTACAATTGGGTTACCTGT
GCGGCGATGAATCAAAAAGTTTGAGTCCAAAATATTCCAACATATATATAGTGCATGCATGCATGCATGCATCTTAATTAGGACGGGCTGGCCTTCATTC
TACTTGCCGTAGAAGGCGCCGGTCTTCATGGCGTCGTCGTTGGCTTGGCCGAGCGCCGCCTCGCTGAGGTACTTGTCGGCGAGCTGCACGCGCTTCACGT
TCTCCTGCTCCTGGACCAGCATGTGGCCGTACTCCATGAGCTTCTCGATGGTCATCTTGGGCTGGTCGAACGTCGGCGGCCCCTCCCTGGAGTTGACGAG
CCGCTTGGAGATGTTCTCCACGCCGATCTCGCCGACCCACTTGCGCACCTCGTCGTCGTACACCCGCGCCCGCAGCGCGCCGAAGAAGTCGATGGACTGC
CCCGGGAAGGTGTCCACCAGCCTCACCACGGCCTCGTCGGGGACGTTGTCGGTGCGGAAGATGCCCTTGCACACGCCGATGCGGTCCTCGCGGGTGGGCG
CCCAGTAGAACTTCTCCATGCGGCCATCGCGGATCAGGGGCGCGTACAGCGTTGAGAAGTCGTTGCCCGTGACGATGATGGGCACGCGGGGGTTCTCCTC
CTTGTTGTACATCCCGGGGAGCTGCACGTTGGTGGGCGCGTCCGCGATGTTCATCAGGGTGGCGTTCACCATCTGGTTGTTCACCGTGTACTGCGTCGTC
CCGCCCATCCGCCCCGCGCCGGCGTCCAGGTCGTTGATGAAGAGGCAGCACATCTTGCCCTTGTTGATAATGTCGGCAGCCTCGCGGTACCTCTGCCGGA
TCAGCTTCGCCGGCTCGCCGGCGTTGCCGCTCTCCAGCTCACCGGCGCTCATCATGATGGGGTTGATGCCCATCTTGGCGAACACCAGCTCGCACTGGAA
CGACTTGCCCTGTCCCTTGCCTCCCCAGATGCCCAGGATGAGAGGAACCTTGATGTTGGGGAGTGTCATGAAGTTCTTGGCGAGGTGGACGATGAGCTTG
TCCATGAATGCCGGGGCGATGTAGAGGCCGTCCATGGTGTTGTCGAAGTCGTACTTCCGCAGGCCCTGGCTGATGTACTCGTAGGAGCTCAGGATGGCCT
CGTGGGTGCCGTCGCCCATGGGGGCCTGGAACAGGGAGTCTACGATACCTTTCCCACTCGTGATGTCCTGCTGGTCGTCGGAGATGTCGTAAGCGAGACC
CTTCCACCTATCGGCATTGGTCTGCTTGCCCTCGTCAAGTTCCTTTTTGGCCGCCATGGCCCTGACCACCTTACTCTTGATCTTGTTGCCACCATGGTAG
TAGTTCAACGCACCGGCCTGCTTCTTCACCTTCTTCCCGAGGAAGGTGGTCGGGGTTGACGCCGGAGCTCCAACGGTGGACGAGAAAGCAGAAGCCATCG
TGTCGATTGTTCACTCCCCGCACCTGCAGATGCAGCTGGACTGAGATCGTCAGTGATCGATGGAGCTG
page-top