Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig19116  (registered. 2012)
Contig Information
Length 1034 bp
Clones alternative view 35 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 3
Wh_oh Pistil at heading date 2
Wh_r Root 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 4
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_SP 6
WH_XB Root 2
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XF Seedling, infected with leaf rust 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115487950|ref|NP_001066462.1|| Os12g0236400 [Oryza sativa (japonica cultivar-group)]
Score 452
Evalue 2.00E-125
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig19116
TCTAGGATGAGTTGCTGTAATTATCTCTGTACCGCTAATAAAAACTTCTCATTCCAAACAAAATTATTCAGAAAAATTCTGAGCTAGCAAAAGCTGTAAT
GAAATTGTGCAATAGTGCACATGCAGACAGAAAATGAGAAACATAGGATGCCGGTATGAGTTTAAAACTTGTAAGAAACCCAGCCGGGGTTTTGTTACAT
GTCACTTTCAAGGTGAAACAGGCCCTTCACGAAAGAGCTTTCTGCACCTCGGCGGTCACTTCCTTTGGTGGTTTCTCCGCATGAAGATTTGCCACTAAGC
CATTCTTGGAGTAGTAGTCAATCACAGGTTCAGTTTGTATGTGGAAAGCTTCAAGCCTTGACTTCAAGACCTCAGCTGTGTCATCTTTTCTTTGAATTAA
GGGTTCTCCCGAAACATCATCAACTCCTGGAGTCTTAGGAGGAGCAAATTTTGTATGGTAAGATCTACCACTCGATGGGTGTATCCAACGGCCAGTAATT
CGTTCTTCCAATATTGCATCATCAATTGCAAAATTTAGAACCTTGTCAACCTTAGCACCTTGCTTTGCCAGCATTTCATCGAGCTTTTGTGCTTGAACAA
CAGTTCTAGGGAAGCCATCAAGGATAAAACCTTTTTGACATGAAGGCTTTTTCATGGCTTCATCAATAATCCCAACAACCAAGTCATCTGAAACAAGCTC
TCCCTTGTCCATAGCTTCTTTAGCCTTGATACCCAGAGGAGTCTTAGCGGCGACAGCAGCCCTCAGCATATCGCCAGTGGCTAAATGGCACAAACAATAT
TCATCCTTAATAAGGGGAGACTGTGTTCCCTTTCCAGAGCCAGGTGGACCGACGAGGATGATGCGCTTGTCGGGCTTGGAGCTGCACTTGGCGCGGCGGA
GCAGCTCGGTCATGAGCTCCACCGAAGGCACGTCCTCGATGTTCGTCGCCATCTCTTCCTCCGCCGGCCGCAACAACGGGAACGACTCGACTCACGTGCC
TGCTGTTTGGCGTGCGGCGCACAAGTCCTACCTC
page-top