Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig19104  (registered. 2012)
Contig Information
Length 647 bp
Clones alternative view 14 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 1
Wh_yd Spikelet at late flowering 4
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_SP 3
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115439261|ref|NP_001043910.1|| Os01g0686800 [Oryza sativa (japonica cultivar-group)]
Score 319
Evalue 1.00E-85
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig19104
ATTATCCATGAGATCATGACTGCGGCTAAGACACAGATAGTAAATTAAGCAGAAGTACCAAGGCAGATATTACGCCTCAAGACAGTCAAAAAAAGAAGAT
ACCACAGCCGTTTTACCAGAACAGAGGCCACTAAAACAAGATACATAATCTAGCTAGAGTAGCTGAACCCCGAGATCTTGTAGATGCGGATAGTTCCATC
GGTGTAACCAGCATAGAGAGTGCTGGCATCCGCGCTCCAGCTCAAGCAAGTGCAGTAGAGCATCTGCTTCGTGGAGACAGGGACCTCGGGCCTAAGGTCC
TGCACGATGTGCTTTGACTCAAGATCCCAGATCTTGATGGAATCCTGTGTCGCCGCGCAGAGCCAGTAGCGGTTGGGCGAGAAGCAAAGTGAGTTGATAA
TGGATCCCGCATCCAGCGAGTAGAGTCTCTTGCCCTCGGTCAAATCCCACAGCAAGGTGACGCCATCCTTGCCACCAGACGCGCAGAGCGAACCGTCTGG
GCTGACCGCGACGGCGCTAACATAGCCACCATGACCATCAAGAGTGCAGCGGAGCTTGCAGTTGGTGAGGTTCCAGACCTTGACGGAGCGGTCCCATGAG
CCCGAGACGATGGTCGGGGCGAAGTTGTTGGGTGAGAAACGGACGCA
page-top